| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2004;43:276.)
© 2004 American Heart Association, Inc.
Scientific Contributions |
From The JDRF Danielle Alberti Memorial Centre for Diabetes Complications, Baker Heart Research Institute, Melbourne, Australia.
Correspondence to Dr Zemin Cao, The JDRF Danielle Alberti Memorial Centre for Diabetes Complications, Baker Medical Research Institute, P.O. Box 6492, St Kilda Road, Central Melbourne 8008, Victoria, Australia. E-mail zemin.cao{at}baker.edu.au
| Abstract |
|---|
|
|
|---|
Key Words: angiotensin receptors vascular endothelial growth factor diabetes
| Introduction |
|---|
|
|
|---|
Although hypoxia is considered the major stimulus for VEGF expression in a site such as the retina, angiotensin II, the major effector molecule of the reninangiotensin system (RAS), is also a known stimulus for VEGF expression.5 Inhibition of the production of angiotensin II with angiotensin-converting enzyme (ACE) inhibition is associated with suppression of VEGF expression in experimental diabetes.6 All components of the RAS, including the angiotensin receptor subtypes, the type 1 (AT1) and type 2 (AT2) receptors, have been demonstrated to be present in the retina.711 Previous studies have shown that the increase in VEGF expression by angiotensin II stimulation was mediated by the AT1 receptor.12 However, the role of the AT2 receptor in mediating VEGF expression remains controversial. The findings from an in vitro study in cultured bovine pericytes suggested no role for this receptor in VEGF induction.5 However, administration of the AT2 receptor antagonist was associated with not only less vascular proliferation but also reduced retinal VEGF expression in a rat model of retinopathy of prematurity.13
Therefore, the aim of the present study was to assess the effect of AT2 receptor antagonism on VEGF expression in two different models, experimental diabetes and angiotensin II infusion.
| Methods |
|---|
|
|
|---|
Protocol 2: Angiotensin II Infusion
Eight-week-old male SD rats were anesthetized with enflurane, then an Alzet osmotic minipump (Model 2002) filled with vehicle (0.15 mol/L NaCl, 1 mmol/L acetic acid, n=8) or human angiotensin II at a concentration of 7 mg/mL was subcutaneously implanted in the mid scapular region as described. Based on the pumping rate of the minipumps (0.5 µL/h), angiotensin II was administered at a dose of 58.3 ng/min. Rats infused with angiotensin II were randomly allocated to angiotensin II infusion alone or treatment with either valsartan or PD123319 (n=8 per group). Administration of valsartan and PD123319 is described above. Separate Alzet minipumps were filled with PD123319 and then inserted subcutaneously on the other side of the mid scapular region. These experiments lasted for 2 weeks.
The protocols for animal experimentation and the handling of animals were approved by the animal ethic committee of our institute and were in accordance with the principles established by the National Health and Medical Research Council of Australia.
Systolic blood pressure (SBP) was measured by indirect tail-cuff plethysmography in prewarmed conscious animals.15 Blood samples were collected from the tail veins of conscious diabetic rats before the animals were euthanized for measurement of glycohemoglobin (HbA1c). HbA1c was measured by a high-performance liquid chromatography method (Biorad, Richmond, Calif). The animals were euthanized by intravenous injection of pentobarbitone sodium at a dose of 60 mg/kg body weight (Boehringer Ingelheim, Artarmon, Australia). One eye from each rat was removed and fixed in 10% formalin and then processed to paraffin for subsequently immunostaining with VEGF. Another eye was enucleated immediately and the retina isolated by blunt dissection using a dissecting microscope. Retinas were then frozen in liquid nitrogen and stored at -80°C for subsequent reverse transcription-polymerase chain reaction (RT-PCR) studies.
RT-PCR
Three micrograms of total RNA extracted from each retina was used to synthesize cDNA with the Superscript First Strand synthesis system for RT-PCR (Life Technologies BRL, Grand Island, NY).16 VEGF gene expression was analyzed by real-time RT-PCR performed with the TaqMan system based on real-time detection of accumulated fluorescence (ABI Prism 7700; Perkin-Elmer, PE Biosystems, Foster City, Calif). To control for variation in the amount of DNA available for PCR in the different samples, gene expression of the target sequence was normalized in relation to the expression of an endogenous control, 18S ribosomal RNA (rRNA) (18S rRNA TaqMan Control Reagent kit; ABI Prism 7700). Primers and TaqMan probe for VEGF and the endogenous reference 18S rRNA were constructed with the help of Primer Express (ABI Prism7700). For amplification of the VEGF cDNA, the forward primer was 5'GCGGGCTGCTGCAATG3', and the reverse primer was 5'TGCAACGCGAGTCTGTGTTT3'. The probe specific for VEGF was FAM-5'-TGCCCACGTCGGAGAGCAACGT-3'-TAMRA. The amplification was performed with the following time course: 50°C for 2 minutes and 95°C for 10 minutes and 50 cycles of 94°C for 20 s and 60°C for 1 minute. Each sample was tested in triplicate. Results were expressed relative to control retina values, which were arbitrarily assigned a value of 1.
Immunohistochemistry
Four-micron-thick sections were cut, dehydrated, and subsequently used for immunohistochemistry. In brief, after dewaxing, sections were treated in a microwave oven at low power for 10 minutes in 10 mmol/L sodium citrate buffer (pH 6.0).14 Endogenous peroxidase was inactivated using 3% hydrogen peroxide in methanol for 20 minutes. The sections were then incubated in protein-blocking agent for 30 minutes followed by incubation with a monoclonal mouse antibody to VEGF (Santa Cruz Biotechnology, Santa Cruz, Calif) overnight at 4°C. Biotinylated horse anti-mouse immunoglobulin G (Vector Laboratories, Burlingame, Calif) was used as the secondary antibody. Sections were then incubated with horseradish peroxidase-conjugated streptavidin. Peroxidase conjugates were localized by 3,3'-diaminobenzidine tetrahydrochloride (Sigma Chemical, St. Louis, Mo) as a chromogen. Sections were counterstained with hematoxylin.
Retinal VEGF immunostaining from both protocols was performed in the same run and then was quantitated using the Imaging Analysis System (AIS; Imaging Research, St. Catherines, Canada) attached to a videocamera and computer. Each slide was graded using the following scale: 0, not detected; 1, weak staining; 2, moderate staining; 3, strong staining; 4, very strong staining. They were graded under a light microscope at a magnification of x200. This analysis was performed in a masked and randomized fashion on 3 retinal sections from each animal and the mean value was determined.
Statistics
Data were analyzed by ANOVA using Statview SE (Brainpower, Calabasas, Calif) on a Macintosh iMac Computer (Cupertino, Calif). Comparisons of group means were performed by Fisher least significant difference method. Data are shown as mean±SEM. A P<0.05 was viewed as statistically significant.
| Results |
|---|
|
|
|---|
|
VEGF Gene Expression
VEGF gene expression was increased approximately 3-fold in the retina of diabetic rats when compared with control animals (Figure 1A). Treatment with either valsartan or PD123319 attenuated VEGF gene expression to a similar level to that observed in the control rats (Figure 1A).
|
VEGF Immunostaining
VEGF protein expression was detected in the cornea, iris, retina, the choroidretinal pigment epithelial complex, ciliary body, the walls of blood vessels, and ocular muscles (data not shown). In the retina of control rats, VEGF staining was predominantly in the inner limiting membrane, ganglion cell layer, and inner nuclear layer (Figure 2A). Weak positive staining for VEGF was also found in the outer limiting membrane and retinal pigment epithelium (Figure 2A). Retinal VEGF protein expression was increased significantly in diabetic rats when compared with control animals (Figure 1B and 2
B). VEGF immunostaining was localized to the same intraretinal sites in diabetic rats as in control animals (Figure 1B and 2
B). The increased VEGF immunostaining in the retina of diabetic rats was attenuated by treatment with either valsartan or PD123319. There was no significant difference in VEGF immunostaining in the retina of diabetic animals treated with either valsartan or PD123319. The levels were similar to that seen in retinae from control rats (Figure 1B, 2
C and D).
|
Protocol 2: Angiotensin II Infusion
Metabolic and Hemodynamic Parameters
The body weight of rats receiving angiotensin II infusion was less than in the rats treated with vehicle at the end of the experiment (Table 2). This effect of angiotensin II on body weight was prevented by co-administration of angiotensin II with valsartan but not PD123319 (Table 2). Angiotensin II infusion was associated with a significant elevation of SBP compared with control rats (Table 2). Treatment with valsartan was associated with prevention of the increase in SBP induced by angiotensin II infusion. By contrast, the AT2 receptor antagonist, PD123319, did not significantly influence SBP in angiotensin II-infused rats.
|
VEGF Gene Expression
VEGF gene expression in the retina in angiotensin II-infused rats was increased approximately 2-fold when compared with control rats (Figure 3A). Treatment with either valsartan or PD123319 was associated with reduced VEGF gene expression. VEGF gene expression in animals treated with either valsartan or PD123319 was similar to that seen in control rats (Figure 3A).
|
VEGF Immunostaining
Retinal VEGF immunostaining was increased in angiotensin II-infused animals when compared with control animals. Both valsartan and PD123319 treatment were associated with attenuated VEGF immunostaining (Figure 3B and Figure 4). No changes in distribution of VEGF immunostaining was observed in any of the treatment groups with VEGF detected specifically in the inner limiting membrane, the ganglion cell layer, and the inner nuclear layer (Figure 4).
|
| Discussion |
|---|
|
|
|---|
Previous studies have described VEGF gene expression in the retina.6 In the present study, we have localized VEGF protein expression to the ganglion cell layer, Muller cells, the inner nuclear layer, and the retinal pigment epithelium. Increased gene and protein expression of VEGF was observed in the retinas of diabetic animals. These findings are consistent with previous reports, albeit using different approaches to assess expression of this growth factor.1,17 VEGF is a major regulator of endothelial cell proliferation, angiogenesis, and vascular permeability.18,19 Increased VEGF production in ocular tissues has been observed at an early stage of diabetes, before the appearance of detectable retinal changes in diabetic animals.3,20
There is now considerable evidence for a direct relationship between the RAS and VEGF.5,21,22 All components of the RAS including angiotensinogen, renin, ACE, angiotensin II, and AT1 and AT2 receptors have been demonstrated to be present in ocular tissues of normal rabbit eyes.8 In cultured bovine retinal pericytes, angiotensin II induced a significant increase in VEGF mRNA levels in a time- and dose-dependent manner.5 In the present study, we demonstrated increased gene and protein expression of VEGF in the retina after long-term angiotensin II infusion. In addition, our previous studies have demonstrated that ACE inhibition reduces retinal VEGF expression.23 Furthermore, angiotensin II had a growth-promoting effect on cultured endothelial cells, and this effect was inhibited by a VEGF neutralizing antibody.5 These findings suggest that angiotensin II stimulates VEGF expression, and this may be implicated in the pathogenesis of retinal disease.
In the present study, the AT1 receptor antagonist, valsartan, reduced retinal VEGF expression in diabetic and angiotensin II-infused rats. These findings are consistent with the previous reports in which AT1 receptor antagonists significantly diminished retinal VEGF gene expression.6,12 These findings followed initial in vitro studies in bovine retinal pericytes, which demonstrated increased VEGF expression in response to angiotensin II via the AT1 receptor subtype.5 The present study extends these findings by confirming that these changes in retinal VEGF gene expression ultimately translate to effects on VEGF protein expression.
The present study demonstrated that the AT2 receptor antagonist reduces retinal VEGF expression in diabetic and angiotensin II-infused animals. This is consistent with the effects of the AT2 receptor antagonist on retinal VEGF expression in the model of retinopathy of prematurity.13 In that study, increased retinal VEGF expression and angiogenesis were observed in the rat model of retinopathy of prematurity.13 Administration of the AT2 receptor antagonist was associated with reduced VEGF expression and retinal angiogenesis.13 These findings from in vivo studies are opposite to a previous in vitro study in cultured bovine pericytes that showed no effects of AT2 receptor blockade on VEGF expression in response to angiotensin II stimulation.5 One must be cautious in extrapolating these in vitro findings in bovine pericytes to the in vivo context. Indeed, the status of the AT2 receptor in cultured bovine pericytes is unclear and needs to be clarified. Expression of the AT2 receptor in the rat retina has been demonstrated using autoradiography and RT-PCR techniques.10,13 Furthermore, using immunohistochemical techniques, the AT2 receptor has been localized to blood vessels, the inner limiting membrane, and in the inner nuclear layer in rat retina.13
It has previously been considered that the AT1 and AT2 receptors may exert opposite effects in terms of cellular proliferation, apoptosis, and blood pressure regulation, and that only the AT1 receptor subtype is important in mediating the actions of angiotensin II. However, there is increasing evidence to suggest that the AT2 receptor plays an important role in modulating cellular proliferation and matrix protein accumulation in the kidney,24 as well as modulating antiproliferative effects in the mesenteric arterial tree.15 Findings from in vivo studies have demonstrated that the AT2 receptor activates nuclear transcription factor kappa B25 and has trophic effects on blood vessels.25,26 Our findings show that the AT2 receptor antagonist PD123319 reduces the retinal expression of VEGF in diabetic animals, similar to effects seen with the AT1 receptor antagonist, valsartan. These findings highlight the importance of angiotensin receptor subtypes in retinal angiogenesis and suggest that blockade of the AT2 receptor as well as the AT1 receptor may confer end organ protection in various retinal diseases.
| Acknowledgments |
|---|
Received October 14, 2003; first decision November 11, 2003; accepted December 9, 2003.
| References |
|---|
|
|
|---|
2. Aiello LP, Pierce EA, Foley ED, Takagi H, Chen H, Riddle L, Ferrara N, King GL, Smith LE. Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins. Proc Natl Acad Sci U S A. 1995; 92: 1045710461.
3. Sone H, Kawakami Y, Okuda Y, Sekine Y, Honmura S, Matsuo K, Segawa T, Suzuki H, Yamashita K. Ocular vascular endothelial growth factor levels in diabetic rats are elevated before observable retinal proliferative changes. Diabetologia. 1997; 40: 726730.[CrossRef][Medline] [Order article via Infotrieve]
4. Aiello LP, Wong JS. Role of vascular endothelial growth factor in diabetic vascular complications. Kidney Int Suppl. 2000; 77: S113S119.[Medline] [Order article via Infotrieve]
5. Otani A, Takagi H, Oh H, Suzuma K, Matsumura M, Ikeda E, Honda Y. Angiotensin II-stimulated vascular endothelial growth factor expression in bovine retinal pericytes. Invest Ophthalmol Vis Sci. 2000; 41: 11921199.
6. Moravski CJ, Kelly DJ, Cooper ME, Gilbert RE, Bertram JF, Shahinfar S, Skinner SL, Wilkinson-Berka JL. Retinal neovascularization is prevented by blockade of the renin-angiotensin system. Hypertension. 2000; 36: 10991104.
7. Murata M, Nakagawa M, Takahashi S. Angiotensinogen mRNA is synthesized locally in rat ocular tissues. Ophthalmologica. 1997; 211: 301304.[Medline] [Order article via Infotrieve]
8. Ramirez M, Davidson EA, Luttenauer L, Elena PP, Cumin F, Mathis GA, De Gasparo M. The renin-angiotensin system in the rabbit eye. J Ocul Pharmacol Ther. 1996; 12: 299312.[Medline] [Order article via Infotrieve]
9. Danser AH, Derkx FH, Admiraal PJ, Deinum J, de Jong PT, Schalekamp MA. Angiotensin levels in the eye. Invest Ophthalmol Vis Sci. 1994; 35: 10081018.
10. Wheeler-Schilling TH, Kohler K, Sautter M, Guenther E. Angiotensin II receptor subtype gene expression and cellular localization in the retina and non-neuronal ocular tissues of the rat. Eur J Neurosci. 1999; 11: 33873394.[CrossRef][Medline] [Order article via Infotrieve]
11. Murata M, Nakagawa M, Takahashi S. Expression and localization of angiotensin II type 1 receptor mRNA in rat ocular tissues. Ophthalmologica. 1997; 211: 384386.[Medline] [Order article via Infotrieve]
12. Nagisa Y, Shintani A, Nakagawa S. The angiotensin II receptor antagonist candesartan cilexetil (TCV-116) ameliorates retinal disorders in rats. Diabetologia. 2001; 44: 883888.[CrossRef][Medline] [Order article via Infotrieve]
13. Sarlos S, Rizkalla B, Moravski CJ, Cao Z, Cooper ME, Wilkinson-Berka JL. Retinal angiogenesis is mediated by an interaction between the angiotensin type 2 receptor, VEGF, and angiopoietin. Am J Pathol. 2003; 163: 879887.
14. Cao Z, Kelly DJ, Cox A, Casley D, Forbes JM, Martinello P, Dean R, Gilbert RE, Cooper ME. Angiotensin type 2 receptor is expressed in the adult rat kidney and promotes cellular proliferation and apoptosis. Kidney Int. 2000; 58: 24372451.[CrossRef][Medline] [Order article via Infotrieve]
15. Cao Z, Dean R, Wu L, Casley D, Cooper ME. Role of angiotensin receptors subtypes in mesenteric vascular proliferation and hypertrophy. Hypertension. 1999; 34: 408414.
16. Bonnet F, Cooper M, Kawachi H, Allen T, Bonner G, Cao Z. Irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. Diabetologia. 2001; 44: 874877.[CrossRef][Medline] [Order article via Infotrieve]
17. Cooper ME, Vranes D, Youssef S, Stacker SA, Cox AJ, Rizkalla B, Casley DJ, Bach LA, Kelly DJ, Gilbert RE. Increased renal expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes. Diabetes. 1999; 48: 22292239.[Abstract]
18. Ferrara N. Role of vascular endothelial growth factor in the regulation of angiogenesis. Kidney Int. 1999; 56: 794814.[CrossRef][Medline] [Order article via Infotrieve]
19. Ferrara N. Molecular biological properties of vascular endothelial growth factor. J Mol Med. 1999; 77: 527543.[CrossRef][Medline] [Order article via Infotrieve]
20. Hammes HP, Lin J, Bretzel RG, Brownlee M, Breier G. Upregulation of the vascular endothelial growth factor/vascular endothelial growth factor receptor system in experimental background diabetic retinopathy of the rat. Diabetes. 1998; 47: 401406.[Abstract]
21. Fujiyama S, Matsubara H, Nozawa Y, Maruyama K, Mori Y, Tsutsumi Y, Masaki H, Uchiyama Y, Koyama Y, Nose A, Iba O, Tateishi E, Ogata N, Jyo N, Higashiyama S, Iwasaka T. Angiotensin AT(1) and AT(2) receptors differentially regulate angiopoietin-2 and vascular endothelial growth factor expression and angiogenesis by modulating heparin binding-epidermal growth factor (EGF)-mediated EGF receptor transactivation. Circ Res. 2001; 88: 2229.
22. Otani A, Takagi H, Suzuma K, Honda Y. Angiotensin II potentiates vascular endothelial growth factor-induced angiogenic activity in retinal microcapillary endothelial cells. Circ Res. 1998; 82: 619628.
23. Gilbert RE, Kelly DJ, Cox AJ, Wilkinson-Berka JL, Rumble JR, Osicka T, Panagiotopoulos S, Lee V, Hendrich EC, Jerums G, Cooper ME. Angiotensin converting enzyme inhibition reduces retinal overexpression of vascular endothelial growth factor and hyperpermeability in experimental diabetes. Diabetologia. 2000; 43: 13601367.[CrossRef][Medline] [Order article via Infotrieve]
24. Cao Z, Bonnet F, Candido R, Nesteroff SP, Burns WC, Kawachi H, Shimizu F, Carey RM, De Gasparo M, Cooper ME. Angiotensin type 2 receptor antagonism confers renal protection in a rat model of progressive renal injury. J Am Soc Nephrol. 2002; 13: 17731787.
25. Wolf G, Wenzel U, Burns KD, Harris RC, Stahl RA, Thaiss F. Angiotensin II activates nuclear transcription factor-kappaB through AT1 and AT2 receptors. Kidney Int. 2002; 61: 19861995.[CrossRef][Medline] [Order article via Infotrieve]
26. Levy BI, Benessiano J, Henrion D, Caputo L, Heymes C, Duriez M, Poitevin P, Samuel JL. Chronic blockade of AT2-subtype receptors prevents the effect of angiotensin II on the rat vascular structure. J Clin Invest. 1996; 98: 418425.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
C. Clapp, S. Thebault, M. C. Jeziorski, and G. Martinez De La Escalera Peptide Hormone Regulation of Angiogenesis Physiol Rev, October 1, 2009; 89(4): 1177 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Ager, J. Neo, and C. Christophi The renin-angiotensin system and malignancy Carcinogenesis, September 1, 2008; 29(9): 1675 - 1684. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chen, A. M. Guo, P. A. Edwards, G. Trick, and A. G. Scicli Role of NADPH oxidase and ANG II in diabetes-induced retinal leukostasis Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1619 - R1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nagai, K. Izumi-Nagai, Y. Oike, T. Koto, S. Satofuka, Y. Ozawa, K. Yamashiro, M. Inoue, K. Tsubota, K. Umezawa, et al. Suppression of Diabetes-Induced Retinal Inflammation by Blocking the Angiotensin II Type 1 Receptor or Its Downstream Nuclear Factor-{kappa}B Pathway Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 4342 - 4350. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Muller and F. C. Luft Direct Renin Inhibition with Aliskiren in Hypertension and Target Organ Damage Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 221 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Sasso, D. Torella, O. Carbonara, G. M. Ellison, M. Torella, M. Scardone, C. Marra, R. Nasti, R. Marfella, D. Cozzolino, et al. Increased Vascular Endothelial Growth Factor Expression But Impaired Vascular Endothelial Growth Factor Receptor Signaling in the Myocardium of Type 2 Diabetic Patients With Chronic Coronary Heart Disease J. Am. Coll. Cardiol., September 6, 2005; 46(5): 827 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bedard, B. Sicotte, J. St-Louis, and M. Brochu Modulation of body fluids and angiotensin II receptors in a rat model of intra-uterine growth restriction J. Physiol., February 1, 2005; 562(3): 937 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Phipps, E. L. Fletcher, and A. J. Vingrys Paired-Flash Identification of Rod and Cone Dysfunction in the Diabetic Rat Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4592 - 4600. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |