Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2004;43:282-285
Published online before print January 12, 2004, doi: 10.1161/01.HYP.0000111584.15095.8a
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
43/2/282    most recent
01.HYP.0000111584.15095.8av1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Related Collections
Right arrow Other hypertension
Right arrow Energy metabolism
Right arrow Genetics of cardiovascular disease

(Hypertension. 2004;43:282.)
© 2004 American Heart Association, Inc.


Scientific Contributions

Dietary NaCl Regulates Renal Aminopeptidase N: Relevance to Hypertension in the Dahl Rat

Mariam Farjah; Theressia L. Washington; Bryan P. Roxas; David L. Geenen; Robert S. Danziger

From the Section of Cardiology (M.F., T.L.W., B.P.R., D.L.G., R.S.D.), Department of Medicine, University of Illinois at Chicago, and West Side Division Veterans Administration (M.F., B.P.R., R.S.D.), Chicago Health Care System, Chicago, Ill.

Correspondence to Dr Robert S. Danziger, Department of Medicine, University of Illinois at Chicago, 840 S. Wood St, Chicago, IL 60612. E-mail Rdanziger{at}aol.com


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Aminopeptidase N (APN) is an abundant metallohydrolase in the brush border of kidney proximal tubule cells that degrades angiotensin III (Ang III) to angiotensin IV (Ang IV) and, along with dipeptidylaminopeptidase, degrades Ang IV. We examined the impact of a high-salt diet on renal APN activity and transcript abundance in the Sprague-Dawley and Dahl salt-sensitive (SS/Jr) rat strains. APN transcript abundance and protein abundance were {approx}2-fold greater (P<0.05; n=6) in the kidneys of Sprague-Dawley and Lewis rats ingesting 8% versus 0.3% salt diets, suggesting that increased aminopeptidase activity may contribute to decreased renal sodium uptake during adaptation to a high-salt diet. In contrast, renal APN transcript abundance and activity were the same in Dahl SS/Jr rats ingesting 8.0% versus 0.3% salt diets. The APN gene was mapped, using a radiation-hybrid panel, to known quantitative loci on chromosome 1 for blood pressure in the Dahl SS/Jr rat. The results suggest that the APN gene is a good candidate for salt-sensitivity in the Dahl SS/Jr rat.


Key Words: sodium • kidney • Dahl rat • angiotensin • hypertension


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Angiotensin II (Ang II) is metabolized to angiotensin III (Ang III) (Arg-Val-Tyr-lle-His-Pro-Phe) by aminopeptidase A. In turn, APN metabolizes Ang III to Ang IV (Val-Tyr-IIe-His-Pro-Phe) and, along with dipeptidylaminopeptidase, degrades Ang IV.1 Ang III shares many of the physiological functions of Ang II in the cardiovascular and nervous systems, including stimulation of vasopressin, aldosterone, and catecholamine secretion.1 Similar to Ang II, it acts as a pro-inflammatory agent by stimulating MCP-1 cytokine production and activating NF-kB and AP-1. Ang III has been postulated to contribute to the inflammatory response and cell growth with progression of renal disease.2,3 However, Ang IV is thought to have minor biological activity because Ang II receptors AT1 and AT2 have poor affinity for Ang IV, and Ang IV infusion does not elicit Ang II-dependent effects.4,5 Recently, receptors for Ang IV have been detected in cortical collecting ducts and mesangial cells6 and Ang IV, in contrast to Ang III, has been shown to increase renal blood flow and cerebral vasodilation.7 Thus, APN may be in a critical position to modulate salt uptake in nephrons and renal vascular resistance by controlling the metabolism of Ang III to Ang IV. We hypothesized that APN may play a mechanistic role in salt adaptation and hypertension.

APN is a major constituent of the brush-border membranes of kidney proximal tubule cells and enterocytes.8,9 APN (IUBMB enzyme nomenclature ec 3.4.11.2, ap-n), known also as microsomal aminopeptidase or aminopeptidase M, is a homodimeric, membrane-bound, zinc-dependent peptidase particle-bound aminopeptidase that preferentially releases neutral amino acids from the N-terminal end of oligopeptides and has specificity similar to that of cytosolic leucine aminopeptidase.10,11. APN belongs to the M1 family of the MA clan of peptidases, which includes membrane-bound type II glycoproteins and has been cloned from 6 different mammalian species. In the present study, we examined the impact of dietary salt content on renal APN in normotensive and Dahl salt-sensitive (SS) rats.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals
The animal-use protocols were approved by the Chicago-West Side Veterans Administration Institutional Animal Care and Use Committee. Male Sprague-Dawley, Lewis, and Dahl SS/Jr rats weighing 250 to 300 grams and obtained from Harlan Sprague-Dawley (Indianapolis, Ind) were administered basal (0.3%) and high-salt (8%) rat-chow diets (Purina series 5500) for 10 days. Urinary sodium was measured to confirm diets. Intra-aortic measurements of blood pressure were performed as previously described.12 Telemetric blood pressure measurements of these arrivals have previously been reported.12

RNA Preparation
Kidneys were removed and fast-frozen in liquid nitrogen. Total RNA was isolated with TRIzol (Invitrogen), with subsequent removal of residual contaminants by using the RNeasy Total RNA Isolation Kit (Qiagen). For high-quality poly(A)+ mRNA, total RNA prepared by TRIzol was followed by use of the Oligotex mRNA kit (Qiagen).

Real-Time Polymerase Chain Reaction
SYBR green polymerase chain reaction (PCR) amplifications were performed as previously described.12 APN primers were designed on the basis of GenBank database accession number AFO39890 (Rattus norvegicus APN gene, exon 2, and partial cds) using Primer Express Software version 1.0 (PE Applied Biosystems) and checked by running virtual PCR (forward: 5' TCCTGGAGCCTGGTGAATCC 3'; reverse: 5, GGAAAGGCGGTGACACTAAT 3'). Primers for GAPDH were as follows: forward = 5' GAAGGGCTCATGACCACAGT 3'; reverse = 5' GGATGCAGGGATGATGTTCT 3'. PCR yielded unique bands of the predicted sizes. Sequencing of these cloned products verified gene specificity. Near-log–linear amplification was observed, with amplification occurring between cycles 26 and 32. Each sample and reaction was replicated 3 times. Expression was normalized to GAPDH as an endogenous reference and relative to basal salt gene expression as a calibrator.

Western Analysis
Immunoblot analysis of kidney homogenates was performed as previously described.12 Membranes were immunoprobed with mouse polyclonal antihuman APN antibody (CD13 Ab-3 Laboratory Vision). Secondary antibody was a goat antimouse IgG HRP-conjugated antibody (Santa Cruz Biotechnology). Blots were controlled for differences in sample loading by normalization to actin.

APN Activity
APN activity was measured in total kidney extract (prepared as described for Western blots) by the methods of Ryan et al13 and Salardi et al,14 except we used fluorogenic substrate Arg-Phe-AFC (Enzyme System Products, Livermore, Calif) rather than radioactive substrate. The rate of fluorescence increase was linear for >20 minutes. Substrate without kidney extract was used as blank. The enzyme activity was expressed as micromoles of AFC produced per minute per milligram of protein using authentic AFC as a calibrator.

Radiation Hybrid Mapping
A rat–hamster hybrid panel consisting of 106 clones with an average locus retention rate of 28% created by Peter Goodfellow (Cambridge, UK) (Research Genetics, Huntsville, AL) was used. Each marker was tested separately (none was multiplexed) and screened at least twice. The presence or absence of the aminopeptidase gene was determined by PCR using gene-specific primers (forward: 5' ATTTGCCCCCTTTTTACGAG 3'; reverse: 5' ACTGCATGGGAATGTCACAA 3'; predicted product size: 448 bp). PCR products were resolved on a 3% agarose gel and analyzed using the Bio-Rad gel documentation system. The data were submitted to the Otsuka Gene Research Institute (http://e4000.otsuka.gr.jp:8012/cgi-bin/RH/rhNgv.pl) for testing against framework maps.

Gene locus markers were integrated into the virtual comparative map (http://rgd.mcw.edu/tools/vcmap/vcmap.cgi?Ver=5.0) and related to known quantitative trait locus (QTL) and rat hormone markers using Medical College of Ohio (http://home.mco.edu/depts/physiology/research/rat/marker.html), Massachusetts Institute of Technology (http://www-genome.wi.mit.edu/rat/public/),Oxford (http://www.well.ox.ac.uk/rat_mapping_resources/), and Arb (http://www.niams.nih.gov/rtbc/ratgbase/index.htm) linkage and rat hormone maps.

Statistics
Transcript/protein abundance and activities within strains were compared using ANOVA and change between strains by 2-sided t test. Significance was set at a level of P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Blood Pressure and Weights
In Sprague-Dawley rats, arterial blood pressure was the same on 0.3% and 8% salt diets (116±4 mm Hg versus 116±7 mm Hg). In Dahl SS rats, blood pressure was greater on 8% versus 0.3% salt diet (147±8 mm Hg versus 116±6 mm Hg, respectively; P<0.01).

Renal APN Transcript and Protein Abundance
Renal APN transcript abundance (Figure 1A) in kidneys was the same in Sprague-Dawley, Lewis, and Dahl SS/Jr rats on 0.3% salt diets. On 8% salt diets, transcript abundance was {approx}2.5-fold greater than in 0.3% salt (P<0.01) in the Sprague-Dawley rats and the same in the Dahl SS/Jr rats on 0.3% salt. Renal APN protein abundance (Figure 1B) in the three rat strains on 0.3% salt diets was the same. On 8% salt, abundance was 3-fold and 2-fold greater in Sprague-Dawley and Lewis rats, respectively, than in Dahl SS/Jr rats (P<0.05). Thus, protein and transcript abundance parallel each other in both strains.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. APN abundance in kidneys from Sprague-Dawley, Lewis, and Dahl SS/Jr rats on 8% or 0.3% salt diets (see Methods). A, APN transcript abundance measured by (kinetic) RT-PCR using SYBR green. B, APN protein abundance determined by Western analysis (see Methods). Expression of genes within strains compared by ANOVA and change between strains by 2-sided t test. Mean±SE; n=number of rats.

Renal APN Activity
APN activity was measured in membrane extracts from kidneys after 10 days on either 8% or 0.3% salt diets (Figure 2). On a 0.3% salt diet, activity was {approx}3-fold and 2- fold greater in Dahl SS/Jr and Lewis rats versus Sprague-Dawley rats. APN activity was increased by {approx}10-fold and 2-fold in Sprague-Dawley and Lewis rats, respectively, on 8% versus 0.3% salt diets. However, there was no change in activity in the Dahl SS/Jr rats on the same diets.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Total APN activity in membrane extracts from kidneys of Sprague-Dawley, Lewis, and Dahl SS/Jr rats on 8% and 0.3% salt diets (see Methods). Expression of genes within strains compared by ANOVA and change between strains by 2-sided t test. Mean±SE; n=number of rats.

Chromosomal Mapping of APN Gene
The marker was detected in 26% of the hybrids. LOD score from 2-point analysis showed close correlation of the locus to D1Rat42, D1Rat38, D1Got122, and D1Got115. The closest linkage was with D1Rat42 ({theta}=0.086, LOD=17.749). D1Rat42 and D1Rat38 were within blood pressure QTL 1b, which was congenically defined in Dahl SS/Jr X Lewis.15 The relationship to other markers and crosses are indicated in Figure 3.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Schematic diagram of a virtual chromosome 1 with relative map position of APN to blood pressure QTL and other markers. Marker positions in defined crosses as designated on right side of figure (see Methods).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The results suggest that APN may mediate salt-adaptation and play a role in the pathogenesis of SS hypertension. Adaptation to a high-salt diet in the Sprague-Dawley and Lewis rats is accompanied by increased APN abundance and activity, suggesting that increased metabolism of Ang III to Ang IV may be a mechanism for reducing Na+ uptake and renal vascular resistance in adaptation to a high-salt diet. From the present studies, it is not possible to determine whether a change in APN activity contributes to the development versus maintenance of pressure in salt-adaptation, because the temporal relationship of the increase in blood pressure to the increase in APN transcript in the rats was not evaluated. In contrast, a high-salt diet does not increase renal APN abundance or activity in Dahl SS/Jr rats. This is consistent with the hypothesis that reduced APN activity contributes to salt-sensitivity. Because Ang III acts on AT2 receptors, which are present in the thick ascending loop of Henle, less metabolism of Ang III in Dahl SS rats on an 8% salt diet may be a mechanism for increased sodium uptake in the thick ascending loop of Henle in the Dahl SS rat.16–18

Because reduced plasma Ang I and Ang II, renin, and aldosterone levels have been found in the Dahl SS rats,19–25 the RAS system has generally been thought to undergo normal compensatory changes in response to hypertension and not play a role in the pathogenesis of hypertension in this strain. However, the present findings raise the possibility that Ang III and IV play a mechanistic role in salt adaptation and in the pathogenesis of hypertension. These measurements may also help explain the finding of greater renal APN activity in the Dahl SS/Jr than in the Sprague-Dawley on a 0.3% salt diet, even though there is greater renal uptake of Na+ in the Dahl SS/Jr rat. To further address this requires measurements of angiotensin metabolites, including angiotensins II, III, and IV, in these rat strains. The possibility that other APN substrates, which include a variety of aliphatic branched N-terminal amino acids,26 play a role in blood pressure cannot be ruled out.

Further support for APN as a candidate gene for hypertension in the Dahl SS/Jr rat is provided by the finding that it maps to a reported blood pressure QTL on chromosome 1.27,28 This is consistent with, but does not demonstrate, APN as the culprit gene within the QTL that affects blood pressure. Because this QTL was determined from a series of congenic rat strains with segments of chromosome 1 from Lewis rats introgressed into Dahl SS/Jr,27,28 this provides additional support for APN as a candidate gene in the Dahl SS/Jr rat, because we have identified it by comparing the Lewis strain and the Sprague-Dawley rat strain, which is the progenitor strain, to the Dahl SS/Jr rat.

Because selection in the present study was based on differences in gene transcript abundance, we speculate that functional polymorphisms/alleles of the APN gene associated with SS hypertension are in noncoding flanking and/or intronic regions of the APN gene, because there is altered regulation of transcript abundance. The APN gene consists of 20 exons that encode segments differing in size from 18 to 205 amino acids.11 However, the possibility that there are functional differences in the coding region cannot be excluded, especially because APN activity is different in Sprague-Dawley versus Lewis and Dahl SS/Jr rats on 0.3% salt diets, even though APN protein abundance is the same. If post-translational modifications of APN, rather than the APN gene, are important in the pathogenesis of hypertension, genes for the culprit modifiers (eg, kinases, phosphatases, and the like) should cosegregate with hypertension rather than the APN gene. Sequencing and further cosegregation analysis should help to resolve this in the future.

Perspectives
The role that aminopeptidases and APN play in human blood pressure remains to be determined. Thirty-three polymorphisms in the adipocyte-derived leucine aminopeptidase gene have been identified, one of which (a Lys528Arg polymorphism) recently has been associated with essential human hypertension.29 The APN gene has been assigned to the long-arm region (q11-qter) of human chromosome 15, a region in which there is evidence for a QTL for blood pressure.30


*    Acknowledgments
 
The authors received the Veterans Administration Advanced Career Development Award (R.S.D.), American Heart Association grant-in-aid (R.S.D.), and NIH MIRS fellowship on R37 HL 22231 (T.W.).

Received June 11, 2003; first decision July 2, 2003; accepted November 18, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ardaillou R, Chansel D. Synthesis and effects of active fragments of angiotensin II. Kidney Int. 1997; 52: 1458–1468.[Medline] [Order article via Infotrieve]

2. Ruiz-Ortega M, Lorenzo O, Ruperez M, Esteban V, Suzuki Y, Mezzano S, Plaza JJ, Egido J. Role of the renin-angiotensin system in vascular diseases: expanding the field. Hypertension. 2001; 38: 1382–1387.[Abstract/Free Full Text]

3. Ruiz-Ortega M, Lorenzo O, Ruperez M, Suzuki Y, Egido J. Angiotensin II activates nuclear transcription factor-kappaB in aorta of normal rats and in vascular smooth muscle cells of AT1 knockout mice. Nephrol Dial Transplant. 2001; 16: 27–33.[Abstract/Free Full Text]

4. Blair-West JR, Coghlan JP, Denton DA, Funder JW, Scoggins BA, Wright RD. The effect of the heptapeptide (2–8) and hexapeptide (3–8) fragments of angiotensin II on aldosterone secretion. J Clin Endocrinol Metab. 1971; 32: 575–578.[Abstract/Free Full Text]

5. Fitzsimons JT. The effect on drinking of peptide precursors and of shorter chain peptide fragments of angiotensin II injected into the rat’s diencephalon. J Physiol. 1971; 214: 295–303.[Abstract/Free Full Text]

6. Czekalski S, Chansel D, Vandermeersch S, Ronco P, Ardaillou R. Evidence for angiotensin IV receptors in human collecting duct cells. Kidney Int. 1996; 50: 1125–1131.[Medline] [Order article via Infotrieve]

7. Harding JW, Wright JW, Swanson GN, Hanesworth JM, Krebs LT. AT4 receptors: specificity and distribution. Kidney Int. 1994; 46: 1510–1512.[Medline] [Order article via Infotrieve]

8. Kenny AJ, Maroux S. Topology of microvillar membrance hydrolases of kidney and intestine. Physiol Rev. 1982; 62: 91–128.[Free Full Text]

9. Olsen J, Kokholm K, Noren O, Sjostrom H. Structure and expression of aminopeptidase N. Adv Exp Med Biol. 1997; 421: 47–57.[Medline] [Order article via Infotrieve]

10. Noren O, Sjostrom H, Olsen J. Aminopeptidase N. In: Kenny AJ, Boustead CM, eds. Cell-surface peptidases in health and disease. Oxford: BIOS Scientific; 1997.

11. Sjostrom H, Noren O, Olsen J. Structure and function of aminopeptidase N. Adv Exp Med Biol. 2000; 477: 25–34.[Medline] [Order article via Infotrieve]

12. Farjah M, Roxas BP, Geenen DL, Danziger RS. Dietary salt regulates renal SGK1 abundance: relevance to salt sensitivity in the Dahl rat. Hypertension. 2003; 41: 874–878.[Abstract/Free Full Text]

13. Ryan JW, Chung AY, Nearing JA, Valido FA, Shun-Cun C, Berryer P. A radiochemical assay for aminopeptidase N. Anal Biochem. 1993; 210: 27–33.[Medline] [Order article via Infotrieve]

14. Salardi S, Falchetto R, Troffa C, Parenti P, Barber BR, Pastore S, Glorioso N, Bianchi G. Relationships among alterations in renal membrane sodium transport, renin and aminopeptidase M activities in genetic hypertension. Biochim Biophys Acta. 1993; 1182: 22–29.[Medline] [Order article via Infotrieve]

15. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol Rev. 2000; 80: 135–172.[Abstract/Free Full Text]

16. Miyata N, Park F, Li XF, Cowley AW, Jr. Distribution of angiotensin AT1 and AT2 receptor subtypes in the rat kidney. Am J Physiol. 1999; 277: F437–F446.[Medline] [Order article via Infotrieve]

17. Alvarez-Guerra M, Garay RP. Renal Na-K-Cl cotransporter NKCC2 in Dahl salt-sensitive rats. J Hypertens. 2002; 20: 721–727.[CrossRef][Medline] [Order article via Infotrieve]

18. Garay RP, Alvarez-Guerra M, Alda JO, Nazaret C, Soler A, Vargas F. Regulation of renal Na-K-Cl cotransporter NKCC2 by humoral natriuretic factors: relevance in hypertension. Clin Exp Hypertens. 1998; 20: 675–682.[Medline] [Order article via Infotrieve]

19. Tamura K, Chiba E, Yokoyama N, Sumida Y, Yabana M, Tamura N, Takasaki I, Takagi N, Ishii M, Horiuchi M, Umemura S. Renin-angiotensin system and fibronectin gene expression in Dahl Iwai salt-sensitive and salt-resistant rats. J Hypertens. 1999; 17: 81–89.[Medline] [Order article via Infotrieve]

20. Campbell WG, Jr., Gahnem F, Catanzaro DF, James GD, Camargo MJ, Laragh JH, Sealey JE. Plasma and renal prorenin/renin, renin mRNA, and blood pressure in Dahl salt-sensitive and salt-resistant rats. Hypertension. 1996; 27: 1121–1133.[Abstract/Free Full Text]

21. Gomez-Sanchez EP, Zhou M, Gomez-Sanchez CE. Mineralocorticoids, salt and high blood pressure. Steroids. 1996; 61: 184–188.[CrossRef][Medline] [Order article via Infotrieve]

22. Rapp JP. Dahl salt-susceptible and salt-resistant rats. A review. Hypertension. 1982; 4: 753–763.[Free Full Text]

23. Cover CM, Wang JM, St Lezin E, Kurtz TW, Mellon SH. Molecular variants in the P450c11AS gene as determinants of aldosterone synthase activity in the Dahl rat model of hypertension. J Biol Chem. 1995; 270: 16555–16560.[Abstract/Free Full Text]

24. Rapp JP, Dahl LK. Suppression of aldosterone in salt susceptible and salt resistant rats. Endocrinology. 1973; 92: 1286–1289.[Abstract/Free Full Text]

25. Rapp JP, Tan SY, Margolius HS. Plasma mineralocorticoids, plasma renin, and urinary kallikrein in salt-sensitive and salt-resistant rats. Endocr Res Commun. 1978; 5: 35–41.[Medline] [Order article via Infotrieve]

26. Kenny AJ, Stephenson LS, Turner AJ. Cell surface peptidases. In: Kenny AJ, Turner AJ, eds. Mammalian ectoenzymes. Amsterdam: Elsevier Science Publishers; 1987.

27. Saad Y, Garrett MR, Rapp JP. Multiple blood pressure QTL on rat chromosome 1 defined by Dahl rat congenic strains. Physiol Genomics. 2001; 4: 201–214.[Abstract/Free Full Text]

28. Saad Y, Garrett MR, Lee SJ, Dene H, Rapp JP. Localization of a blood pressure QTL on rat chromosome 1 using Dahl rat congenic strains. Physiol Genomics. 1999; 1: 119–125.[Abstract/Free Full Text]

29. Yamamoto N, Nakayama J, Yamakawa-Kobayashi K, Hamaguchi H, Miyazaki R, Arinami T. Identification of 33 polymorphisms in the adipocyte-derived leucine aminopeptidase (ALAP) gene and possible association with hypertension. Hum Mutat. 2002; 19: 251–257.[CrossRef][Medline] [Order article via Infotrieve]

30. Weder AB, Delgado MC, Zhu X, Gleiberman L, Kan D, Chakravarti A. Erythrocyte sodium-lithium countertransport and blood pressure: a genome-wide linkage study. Hypertension. 2003; 41: 842–846.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
L. E. Yang, M. B. Sandberg, A. D. Can, K. Pihakaski-Maunsbach, and A. A. McDonough
Effects of dietary salt on renal Na+ transporter subcellular distribution, abundance, and phosphorylation status
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1003 - F1016.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. Kotlo, S. Shukla, U. Tawar, R. A. Skidgel, and R. S. Danziger
Aminopeptidase N reduces basolateral Na+-K+-ATPase in proximal tubule cells
Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1047 - F1053.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Kotlo, D. E. Hughes, V. L.M. Herrera, N. Ruiz-Opazo, R. H. Costa, R. B. Robey, and R. S. Danziger
Functional Polymorphism of the Anpep Gene Increases Promoter Activity in the Dahl Salt-Resistant Rat
Hypertension, March 1, 2007; 49(3): 467 - 472.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Pisitkun, R.-F. Shen, and M. A. Knepper
Identification and proteomic profiling of exosomes in human urine
PNAS, September 7, 2004; 101(36): 13368 - 13373.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
43/2/282    most recent
01.HYP.0000111584.15095.8av1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farjah, M.
Right arrow Articles by Danziger, R. S.
Related Collections
Right arrow Other hypertension
Right arrow Energy metabolism
Right arrow Genetics of cardiovascular disease