This Article Abstract Full Text (PDF) All Versions of this Article: 43/4/866    most recent 01.HYP.0000121883.55722.45v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chen, S. Articles by Gardner, D. G. Search for Related Content PubMed PubMed Citation Articles by Chen, S. Articles by Gardner, D. G. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH

(Hypertension. 2004;43:866.)
© 2004 American Heart Association, Inc.

Scientific Contributions

Sgk1 Mediates Osmotic Induction of NPR-A Gene in Rat Inner Medullary Collecting Duct Cells

Songcang Chen; James A. McCormick; Kavitha Prabaker; Jian Wang; David Pearce; David G. Gardner

From the Diabetes Center (S.C., K.P., D.G.G.) and Department of Medicine (J.A.M., J.W., D.P., D.G.G.), University of California at San Francisco.

Correspondence to Dr Songcang Chen, Diabetes Center, 1119 HSW, University of California at San Francisco, San Francisco, CA 94143-0540. E-mail schen{at}diabetes.ucsf.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
We have shown previously that increased extracellular osmolality stimulates expression and promoter activity of the type A natriuretic peptide receptor (NPR-A) gene in rat inner medullary collecting duct (IMCD) cells through a mechanism that involves activation of p38 mitogen-activated protein kinase (MAPK). The serum and glucocorticoid inducible kinase (Sgk) is thought to participate in the regulation of sodium handling in distal tubular segments. We sought to determine whether this kinase might be involved in the osmotic stimulation of NPR-A gene promoter activity. Exposure of cultured IMCD cells to an additional 75 mmol/L NaCl in culture media (final osmolality 475 mosm/kg) resulted in an 4-fold increase in Sgk1 protein levels after 7 hours. The Sgk1 induction was almost completely inhibited by the p38 MAPK inhibitor SB203580, indicating that NaCl activates Sgk1 through the p38 MAPK pathway. Transient transfection of a mouse Sgk1 expression vector along with a -1590 NPR-A luciferase reporter resulted in an 3-fold increment in reporter activity, which was significantly reduced by cotransfection with a kinase-dead Sgk1 mutant. The NaCl-dependent induction was partially blocked (40% inhibition) by cotransfection of the kinase-dead Sgk1 mutant. Neither Sgk1 nor the kinase-dead mutant had any effect on endothelial nitric oxide synthase (eNOS) promoter activity, and the Sgk1 mutant and 8-bromo-cyclic guanosine monophosphate were, to some degree, additive in reducing osmotically stimulated NPR-A promoter activity. Collectively, these data imply that Sgk1 operates over an eNOS-independent, p38 MAPK-dependent pathway in mediating osmotic induction of the NPR-A gene promoter.

Key Words: glucocorticoids • kinase • receptors • atrial natriuretic factor • gene regulation • signal transduction

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The inner medullary collecting duct is the terminal nephron segment responsible for the final regulation of urinary sodium content. It is the target of several hormonal systems that promote either sodium retention or sodium excretion.¹ The natriuretic peptides are a family of peptide hormones that promote a natriuretic diuresis in the kidney through a combination of vasoregulatory properties and direct effects on sodium transport in the collecting duct epithelial cell.² There are 3 types of natriuretic peptides and 3 classes of receptors that signal their activities. Atrial natriuretic peptide and brain natriuretic peptide are produced primarily in the heart (atria and ventricles, respectively), whereas C type natriuretic peptide is produced in a variety of extracardiac tissues including the vascular endothelium. Atrial natriuretic peptide and brain natriuretic peptide interact primarily with the type A natriuretic peptide receptor (NPR-A), whereas C type natriuretic peptide binds to and activates the type B receptor (NPR-B).² Each of these receptors is a particulate guanylyl cyclase. Occupancy of the receptor by ligand increases cyclase activity and, thereby, increases cyclic GMP levels in the target cell. In the kidney, it appears to be exclusively NPR-A that signals the natriuretic activity of atrial natriuretic peptide.³

The medullary interstitium that bathes the basolateral surface of the inner medullary collecting duct (IMCD) cell is the only tissue in the body that is almost continuously exposed to a hyperosmotic environment. This increase in tonicity has the potential to control a variety of metabolic processes in these cells, including those responsible for regulating cellular volume.^4–6 We have recently shown that increased extracellular osmolality increases the expression of the gene encoding NPR-A in cultured rat inner medullary collecting duct cells. This increase is heavily dependent on an intact p38 mitogen-activated protein kinase (MAPK) signaling system⁷ and arises, in part (50%), from an osmotic suppression of endothelial nitric oxide synthase (eNOS) and consequent reduction in basal cyclic GMP levels in these cells.⁸ The nature of the NO/cGMP-independent component of the osmo-stimulatory effect has not been defined. As we have noted previously,^7,8 the osmo-induction of NPR-A may represent a natriuretic mechanism for preservation of extracellular tonicity in the face of intravascular volume contraction.

The serum- and glucocorticoid-regulated kinase (Sgk) was originally described in mammary epithelial cells⁹ and subsequently identified as an aldosterone-sensitive gene product in the tubular epithelial cells of the kidney.¹⁰ This kinase appears to be a signaling intermediate linking aldosterone and insulin to increased sodium reabsorption in the collecting duct of the kidney. Sgk1 has previously been shown to respond to osmotic stimuli in hepatic epithelial cells as well as a variety of other cell types,^11–13 leading us to hypothesize that this kinase might serve as an intermediary in the osmotic induction of NPR-A gene expression in IMCD cells. Our studies confirm that Sgk1 is expressed in cultured rat IMCD cells, that this expression is induced by increased extracellular osmolality, and that this, in turn, appears to be linked to the increase in NPR-A gene promoter activity, albeit through an eNOS-independent pathway.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Materials
Anti-rabbit Sgk1 antibody was generously provided by Dr Gary Firestone (University of California at Berkeley). RNeasy mini kit was obtained from QIAGEN (Santa Clara, Calif). Primer-it RMT kit, hybridization solution, and Nuctrap push columns were purchased from Stratagene (La Jolla, Calif). Other reagents were obtained through standard commercial suppliers.

Isolation and Culture of IMCD Cells
Adult Sprague-Dawley female rats were euthanized by CO₂ narcosis followed by bilateral thoracotomy in compliance with a protocol approved by the University of California at San Francisco Committee on Animal Research. The inner medullary tissue from each kidney was dissected free from the outer medulla, minced, and digested with 1 mg/mL collagenase at 37°C with gentle agitation during each 30 minutes cycle. IMCD cells were enriched in the preparation using hypotonic lysis as described previously.¹⁴ The cells were re-suspended in medium-1¹⁵ and seeded on to culture plates. After 24 hours, the cells were placed in K-1 medium¹⁵ without hydrocortisone and cultured for 3 to 4 days.

Plasmid Constructions
The wild-type mouse Sgk1 cDNA (nucleotides 17 to 1436, which include the entire open reading frame) was cloned by reverse-transcriptase polymerase chain reaction from 1 µg mouse kidney total RNA using the RNA PCR Core Kit (Applied Biosystems) in conjunction with the Advantage HF-2 PCR kit (Clontech). The primers 5'GACTGGATCCTTCACTGCTCCCCTCAGTCTCTTTTG3' (sense) and 5'TAGCGTTAACGGCAACTCCACCAAAGGCTAACGAAAAC3' (antisense) were used in a PCR with the following cycling parameters: 94°C for 30 seconds; 60°C for 45 seconds; and 68°C for 90 seconds for 30 cycles followed by 68°C for 15 minutes. The PCR product was ligated into pCRII-TOPO (Invitrogen) to generate mouse Sgk1/pcRII-TOPO and then subcloned into the BamHI and EcoRI sites of the pcDNA3 expression vector to generate Sgk1/pcDNA3. To generate the K127M Sgk1 mutant (Sgk1/K127M), which lacks the lysine essential for the catalytic activity of Sgk1, the QuikChange XL site-directed mutagenesis kit (Stratagene) was used according to the manufacturer’s instructions, with the following primers: 5'GAAGTATTCTATGCAGTCatgGTTTTACAGAAGAAAGCCATCCTG3' (sense) and 5'CAGGATGGCTTTCTTCTGTAAAACcatGACTGCATAGAATACTTC3' (antisense), and Sgk1/K127M/pcRII-TOPO as template (mutated bases are identified in lowercase letters). The resulting Sgk1/K127M was subcloned between the BamHI and EcoRI sites of pcDNA3 to generate Sgk1/K127M/pcDNA3. The full lengths of each construct were sequenced to verify the absence of mutations other than those designed into the K127M mutation itself.

RNA Isolation and Northern Blot Analysis
Primary IMCD cells were treated with 75 mmol/L NaCl in DME H-21/F-12 (1:1) at different time intervals. Total RNA was extracted using the RNeasy minikit, size fractionated by agarose gel electrophoresis, and transferred to membranes. A 1419-bp BamH1/EcoRI fragment of the mouse Sgk1 cDNA was isolated from the Sgk1/pcDNA3 vector, radiolabeled using the primer-it RMT kit, and separated from free nucleotide using Nuctrap push columns. The membranes were hybridized with mouse³²P-labeled Sgk1 cDNA in hybridization solution provided by Stratagene. All membranes were subsequently stripped and rehybridized with a radiolabeled 1150-bp BamHI/EcoRI fragment of 18S rDNA to permit normalization among samples for differences in RNA loading and/or transfer to the filter. Hybridization signals were scanned into a computer and quantified using the National Institutes of Health (NIH) image program.

Transfection and Luciferase Assay
Cells were plated in 6-well plates and grown to 70% confluence. At that time, transfection was performed with Lipofectin Reagent (Life Technologies) using a protocol recommended by the manufacturer. One µg of -1575 NPR-A-LUC with 0.2 µg CMV-ß-galactosidase (ß-gal) and different concentrations of Sgk1/pcDNA3 and/or Sgk1/K127M expression vectors were introduced into each well. The DNA–liposome suspension was incubated in the cultures for 5 to 6 hours at 37°C in Opti-MEMI Reduced Serum Medium (Gibco-BRL). The suspension was then removed and replaced with K-1 medium for the ensuing 24 hours, at which point cells were treated with 75 mmol/L NaCl in K1 medium for 24 hours. Luciferase and ß-galactosidase activities were measured. Luciferase levels were normalized for ß-galactosidase activity in the individual cultures.

Western Blot
The cells were treated with 75 mmol/L NaCl for different time intervals and scraped into lysis buffer.¹⁶ Ten µg total protein was denatured at 100°C for 3 minutes, subjected to 10% SDS-PAGE, and transferred onto PVDF membranes. The membrane was blocked with 5% nonfat milk in TBST (50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, 0.1% Tween 20) and probed with a rabbit polyclonal antibody directed against Sgk1.⁹ A horseradish peroxidase-conjugated second antibody was used to detect immunoreactive bands using the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Chemical). Signal was identified and quantified using NIH Image.

Statistical Analysis
Data were evaluated using 1-way ANOVA with Newman-Keuls test for significance.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Exposure of cultured rat IMCD cells to an additional 75 mmol/L NaCl (final calculated tonicity in the medium=475 mosm/kg H₂O) resulted in 6-fold increase in Sgk1 mRNA levels after only 3 hours of treatment (Figure 1A). This increase decreased slightly over the ensuing 5 hours. The induction by NaCl was almost completely inhibited by the p38 MAPK inhibitor SB203580 (Figure 1B), implying that Sgk1 mRNA induction is dependent on a functional p38 MAPK signaling pathway.

View larger version (18K): [in this window] [in a new window]   Figure 1. Hyperosmolality increases Sgk1 mRNA levels in IMCD cells. A, Cells were treated with 75 mmol/L NaCl for the intervals indicated. Total RNA was collected and Northern blot analysis was performed as described in Methods. Representative results are shown and pooled data (n=4) are presented as normalized Sgk1 mRNA/18S rRNA ratios. B, p38 MAPK inhibitor, SB203580, blocks NaCl-induced increase in Sgk1 mRNA levels. Cells were preincubated with 2x10-5 M SB203580 for 1 hour and then treated with NaCl for 3 hours. Representative autoradiograph and pooled data from 3 independent experiments are shown. *P<0.05, **P<0.01 vs control; +P<0.01 vs NaCl.

The increase in Sgk1 mRNA was accompanied by an increase in Sgk1 protein levels (Figure 2A), which peaked at 4-fold above basal levels after 7 hours of NaCl stimulation, an appropriate lag behind the accumulation of NPR-A mRNA reflecting the time required for new protein synthesis. The sequential stimulation of Sgk1 mRNA and protein and the delayed time course (7 hours to peak protein accumulation) implies that the bulk of the induction arises from increased synthesis rather than activation of Sgk1. The ability to increase Sgk1 was not confined to NaCl. Addition of 150 mmol/L sucrose, but not 150 mmol/L urea, to the culture medium (final tonicity 475 mosm/kg H₂O) resulted in 3-fold increase in Sgk1 protein levels (Figure 2B), indicating that tonicity, per se, contributes to the inductive process. The NaCl-dependent increase in Sgk1 protein levels was almost completely reversed with SB203580 (Figure 2C). SB203580 had a similar effect on sucrose-stimulated Sgk1 protein levels, implying that sucrose and NaCl use a shared osmotic mechanism to drive Sgk1 expression (sucrose: 3.1±0.4 versus sucrose+SB203580: 1.5±0.6; both results expressed as mean fold induction relative to control levels±SD, P<0.005, n=3).

View larger version (26K): [in this window] [in a new window]   Figure 2. Osmotic induction of Sgk1 protein levels in IMCD cells. A, Cells were exposed to 75 mmol/L NaCl for different time intervals as indicated. Cell lysates were size-fractionated by SDS-PAGE and transferred onto membranes that were then probed with anti-Sgk1 antibody. Immunoreactive bands were identified using the ECL system. B, IMCD cells were incubated with 75 mmol/L NaCl, 150 mmol/L sucrose, and 150 mmol/L urea for 7 hours. Cells were lysed and Western blot was performed as described. Pooled data (n=3) are demonstrated. C, IMCD cells were pretreated with 2x10-5 M SB203580 for 1 hour and then incubated with 75 mmol/L NaCl for 7 hours. The lysates were generated and Western blot analysis was performed as described. Pooled data (n=3) are presented. *P<0.05, **P<0.01 vs control; +P<0.01 vs NaCl.

We have previously shown that osmotic stimulation of IMCD cells results in upregulation of NPR-A promoter activity through a p38 MAPK-dependent mechanism.⁷ At least a portion of this stimulation appears to result from osmotic suppression of NO production in these cells.⁸ The reduction in NO levels decreases basal cGMP production and secondarily increases activity of the NPR-A gene promoter. We attempted to determine whether Sgk1 might be involved in mediating at least a component of the osmotic induction of the NPR-A promoter. As shown in Figure 3, cotransfection of an expression vector encoding wild-type Sgk1 together with the -1575 NPR-A luciferase reporter led to 2.5- to 3.0-fold increment in reporter activity at the optimal concentration (1 µg per transfection) of the expression vector. An expression vector encoding a kinase-dead mutant of Sgk (Sgk1/K127M) was devoid of activity when cotransfected with -1575 NPR-A luciferase; however, this mutant, when cotransfected along with the wild-type Sgk1 construct, effected a significant reduction in Sgk1-dependent NPR-A promoter activity, implying that the kinase-dead mutant has the ability to function as a competitive inhibitor of wild-type Sgk1 activity. Wild-type Sgk1 had no effect on the NaCl-dependent induction of luciferase activity, implying that Sgk1 is not limiting for the osmotic induction of the NPR-A gene promoter in these cells.

View larger version (34K): [in this window] [in a new window]   Figure 3. Effect of Sgk1, Sgk1/K127M, and NaCl on NPR-A promoter activity. Different amounts of Sgk1/pcDNA3 or Sgk1/K127M expression vectors, either alone or together, were cotransfected with 1 µg of -1575 NPR-A-LUC and 0.2 µg CMV-ß-galactosidase into IMCD cells with lipofectin. Twenty-four hours later, cells were incubated with 75 mmol/L NaCl or vehicle for 24 hours. Luciferase and ß-galactosidase activities were measured and luciferase levels were normalized for ß-galactosidase activity. Experiments were repeated 6 times; pooled data are shown. *P<0.05, **P<0.01 vs control; +P<0.01 vs corresponding Sgk1 alone.

Of note, Sgk1/K127M was capable of partially inhibiting the NaCl-dependent induction of NPR-A promoter activity (Figure 4). Maximal inhibition (40%) was achieved with 1 to 3 µg of Sgk1/K127M in the transfection. This implies that Sgk1, or a functionally related family member, functions as a mediator of the osmo-induction of NPR-A promoter activity in IMCD cells.

View larger version (39K): [in this window] [in a new window]   Figure 4. Sgk1/K127M partially blocks NaCl-stimulated NPR-A promoter activity. Cells were transfected with 1 µg of -1575 NPR-A-LUC, 0.2 µg CMV-ß-galactosidase, and different concentrations of Sgk1/K127M. Twenty-four hours after transfection, cells were exposed to 75 mmol/L NaCl or vehicle for an additional 24 hours. Luciferase and ß-galactosidase activities were assayed as described. Data are presented from 5 to 6 independent experiments. *P<0.05, **P<0.01 vs control.

This induction appears to be independent of the reduction in eNOS promoter activity that was linked to NPR-A stimulation earlier.⁸ Neither wild-type Sgk1 nor Sgk1/K127M at concentrations shown to affect NPR-A promoter activity had any effect on the cotransfected eNOS promoter. Similarly, Sgk1/K127M failed to reverse the NaCl-dependent suppression of eNOS promoter activity (Figure 5A). Furthermore, while Sgk1/K127M and 8-Br-cGMP provided comparable reductions in NPR-A promoter activity, the inhibition was near additive when the two were used together, suggesting that Sgk1/K127M and eNOS/NO/cGMP operate over independent signaling circuitry.

View larger version (17K): [in this window] [in a new window]   Figure 5. Sgk1 and eNOS operate over independent circuitry. A, Sgk does not mimic NaCl activity. Sgk1/K127M is unable to reverse NaCl-induced inhibition in eNOS promoter; 2 µg Sgk1/pcDNA3 or Sgk1/K127M expression vector were cotransfected with 1 µg of eNOS-LUC and 0.2 µg CMV-ß-galactosidase in IMCD cells. After 40 hours, cells were treated with 75 mmol/L NaCl for 8 hours. Luciferase and ß-galactosidase activities were assayed as described. Data from 3 experiments are presented. **P<0.01 vs control. B, 8-bromo-cGMP amplifies Sgk1/K127M suppression of NaCl-stimulated NPR-A gene promoter activity. Cells were transfected with 1 µg of -1575 NPR-A-LUC and 0.2 µg CMV-ß-galactosidase in the presence or absence of 2 µg Sgk1/K127M; 24 hours after transfection, cells were treated with 10-4 M 8-bromo-cGMP and/or 75 mmol/L NaCl for 24 hours. Luciferase and ß-galactosidase activities were assayed as described. Pooled data (n=4) are presented. **P<0.01 vs NaCl alone, +P<0.05 vs NaCl + Sgk1/K127M or NaCl + 8-bromo-cGMP.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Our previous studies have documented that the NPR-A gene is stimulated by increased osmolality in IMCD cells,⁷ a finding that may have physiological relevance given the high levels of extracellular tonicity that exist in the medullary interstitium. These studies showed that the osmotic induction of the NPR-A gene promoter was almost entirely dependent on increased p38 MAPK activity⁷ and that approximately half of the response resulted from the p38 MAPK-dependent osmotic suppression of eNOS gene expression. The reduction in eNOS was associated with a reduction of basal cGMP levels and subsequent increase in NPR-A promoter activity. The NPR-A gene promoter is inhibited by perturbations that raise cGMP levels in rat aortic smooth muscle cells¹⁷ and IMCD cells.¹⁵

The present study indicates that: (1) the Sgk1 gene is a target of osmotic induction in IMCD cells; (2) that Sgk1, or a closely related family member, participates in the osmotic induction of the NPR-A gene promoter in these cells; and (3) that Sgk1 does so through a mechanism that does not directly involve suppression of the eNOS gene promoter.

Osmotic induction of the Sgk1 gene product has been reported earlier by Bell et al.¹³ By transfecting NmuMg nontransformed mouse mammary epithelial cells with the Sgk1 promoter linked to a chloramphenicol acetyl transferase reporter, they showed that the osmotic stimulation of Sgk1 gene expression was dependent on an increase in Sgk1 gene transcription. They functionally linked this to a Sp1 binding site in the proximal promoter of the Sgk1 gene. Mutation of this site led to a reduction in promoter stimulation by the osmotic stimulus. This varies somewhat from the more typical osmotic induction of promoter activity involving a specific regulatory element termed the osmotic regulatory element (TGGAAAATTAC¹⁸) found in the 5' flanking sequence of a number of osmotically sensitive genes, including those encoding the sodium/myo-inositol co-transporter,⁴ sodium/chloride/betaine co-transporter,⁵ and aldose reductase.⁶ The use of an Sp1 site to mediate the osmotic induction implies that basal transcription factors can be recruited into a regulatory mode in response to changes in extracellular tonicity. Secondary involvement of osmotic regulatory element, or a related structure, in signaling the osmotic induction of the Sgk1 gene has yet to be demonstrated.

Finally, the fact that Sgk1/K127M has no effect on eNOS promoter activity (implying lack of effect on eNOS expression) and the additivity demonstrated between Sgk1/K127M and 8-bromo-cGMP suggest that Sgk1 traffics largely over the eNOS/cGMP-independent pathway (Figure 6) to control NPR-A promoter activity. Signaling events positioned between p38 MAPK activation and eNOS promoter stimulation remain undefined.

View larger version (10K): [in this window] [in a new window]   Figure 6. Schematic diagram depicting signaling events linking osmotic stimulation (increased NaCl) to increased NPR-A gene expression. p38ß MAPK is the beta isoform of p38 MAPK.

Perspectives
The link between Sgk1 and increased NPR-A gene expression is, on the surface, paradoxical. Activation of Sgk1 in A6 cells by aldosterone¹⁰ or insulin¹⁹ has been linked to an increase in sodium current in vitro and, inferentially, an increase in sodium reabsorption in the collecting duct of the kidney. Coincident activation of a natriuretic system like the liganded natriuretic peptide receptor seems counterintuitive. However, the role of Sgk1 in sodium conservation remains complex and only partially understood. Targeted knockout of the Sgk1 gene in mice results in no major perturbation in sodium handling.²⁰ This might result from redundancy of function among different members of the Sgk family (Sgk 2 and 3) or it may suggest that Sgk1 plays an important role in controlling signaling pathways involved in retention and excretion of sodium in the distal nephron. Selective activation of one over the other might result from temporal discrepancies in the individual inductive processes (eg, early activation of aldosterone-dependent sodium retention followed by a later stimulation of natriuretic peptide-dependent natriuresis), which would permit greater fine-tuning in the response to a given physiological stimulus. The mechanism underlying the Sgk1-dependent increase in NPR-A promoter activity is unknown; however, given the kinase activity of the former, one would have to postulate the involvement of a phosphorylated intermediate (eg, transcription factor that is activated by a phosphorylation event).

	Acknowledgments

 
Supported by ROIHL45637 (D.G.G.) and RO1-DK56695 (D.P. from the National Institutes of Health).

Received December 4, 2003; first decision December 22, 2003; accepted February 3, 2004.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Zeidel ML. Hormonal regulation of inner medullary collecting duct sodium transport. Am J Physiol. 1993; 265: F159–F173.

2. Levin ER, Gardner DG, Samson WK. Natriuretic peptides. N Engl J Med. 1998; 339: 321–328.[Free Full Text]

3. Dubois SK, Kishimoto I, Lillis TO, Garbers DL. A genetic model defines the importance of the atrial natriuretic peptide receptor (guanylyl cyclase-A) in the regulation of kidney function. Proc Natl Acad Sci U S A. 2000; 97: 4369–4373.[Abstract/Free Full Text]

4. Yamauchi A, Uchida S, Preston AS, Kwon HM, Handler JS. Hypertonicity stimulates transcription of gene for Na(+)-myo-inositol cotransporter in MDCK cells. Am J Physiol. 1993; 264: F20–F23.

5. Uchida S, Yamauchi A, Preston AS, Kwon HM, Handler JS. Medium tonicity regulates expression of the Na(+)- and Cl(-)-dependent betaine transporter in Madin-Darby canine kidney cells by increasing transcription of the transporter gene. J Clin Invest. 1993; 91: 1604–1607.

6. Smardo FL, Jr., Burg MB, Garcia-Perez A. Kidney aldose reductase gene transcription is osmotically regulated. Am J Physiol. 1992; 262: C776–C782.

7. Chen S, Gardner DG. Osmoregulation of natriuretic peptide receptor signaling in inner medullary collecting duct. A requirement for p38 MAPK. J Biol Chem. 2002; 277: 6037–6043.[Abstract/Free Full Text]

8. Chen S, Cao L, Intengan HD, Humphreys M, Gardner DG. Osmoregulation of endothelial nitric-oxide synthase gene expression in inner medullary collecting duct cells. Role in activation of the type A natriuretic peptide receptor. J Biol Chem. 2002; 277: 32498–32504.[Abstract/Free Full Text]

9. Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol. 1993; 13: 2031–2040.[Abstract/Free Full Text]

10. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A. 1999; 96: 2514–2519.[Abstract/Free Full Text]

11. Waldegger S, Barth P, Raber G, Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A. 1997; 94: 4440–4445.[Abstract/Free Full Text]

12. Rozansky DJ, Wang J, Doan N, Purdy T, Faulk T, Bhargava A, Dawson K, Pearce D. Hypotonic induction of SGK1 and Na+ transport in A6 cells. Am J Physiol Renal Physiol. 2002; 283: F105–F113.[Abstract/Free Full Text]

13. Bell LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, Firestone GL. Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem. 2000; 275: 25262–25272.[Abstract/Free Full Text]

14. Grenier FC, Rollins TE, Smith WL. Kinin-induced prostaglandin synthesis by renal papillary collecting tubule cells in culture. Am J Physiol. 1981; 241: F94–F104.

15. Cao L, Chen SC, Cheng T, Humphreys MH, Gardner DG. Ligand-dependent regulation of NPR-A gene expression in inner medullary collecting duct cells. Am J Physiol. 1998; 275: F119–F125.

16. Chen S, Gardner DG. Retinoic acid uses divergent mechanisms to activate or suppress mitogenesis in rat aortic smooth muscle cells. J Clin Invest. 1998; 102: 653–662.[Medline] [Order article via Infotrieve]

17. Cao L, Wu J, Gardner DG. Atrial natriuretic peptide suppresses the transcription of its guanylyl cyclase-linked receptor. J Biol Chem. 1995; 270: 24891–24897.[Abstract/Free Full Text]

18. Ferraris JD, Williams CK, Ohtaka A, Garcia-Perez A. Functional consensus for mammalian osmotic response elements. Am J Physiol. 1999; 276: C667–C673.

19. Wang J, Barbry P, Maiyar AC, Rozansky DJ, Bhargava A, Leong M, Firestone GL, Pearce D. SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. Am J Physiol Renal Physiol. 2001; 280: F303–F313.[Abstract/Free Full Text]

20. Wulff P, Vallon V, Huang DY, Volkl H, Yu F, Richter K, Jansen M, Schlunz M, Klingel K, Loffing J, Kauselmann G, Bosl MR, Lang F, Kuhl D. Impaired renal Na(+) retention in the sgk1-knockout mouse. J Clin Invest. 2002; 110: 1263–1268.[CrossRef][Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				S. de Seigneux, V. Leroy, H. Ghzili, M. Rousselot, S. Nielsen, B. C. Rossier, P.-Y. Martin, and E. Feraille NF-{kappa}B Inhibits Sodium Transport via Down-regulation of SGK1 in Renal Collecting Duct Principal Cells J. Biol. Chem., September 12, 2008; 283(37): 25671 - 25681. [Abstract] [Full Text] [PDF]

				A. M. Richards Natriuretic Peptides: Update on Peptide Release, Bioactivity, and Clinical Use Hypertension, July 1, 2007; 50(1): 25 - 30. [Full Text] [PDF]

				F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol Rev, October 1, 2006; 86(4): 1151 - 1178. [Abstract] [Full Text] [PDF]

				C. Boyd and A. Naray-Fejes-Toth Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1 Am J Physiol Renal Physiol, March 1, 2005; 288(3): F505 - F512. [Abstract] [Full Text] [PDF]

				R. Zhou and P. M. Snyder Nedd4-2 Phosphorylation Induces Serum and Glucocorticoid-regulated Kinase (SGK) Ubiquitination and Degradation J. Biol. Chem., February 11, 2005; 280(6): 4518 - 4523. [Abstract] [Full Text] [PDF]

				V. Vallon, P. Wulff, D. Y. Huang, J. Loffing, H. Volkl, D. Kuhl, and F. Lang Role of Sgk1 in salt and potassium homeostasis Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R4 - R10. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 43/4/866    most recent 01.HYP.0000121883.55722.45v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chen, S. Articles by Gardner, D. G. Search for Related Content PubMed PubMed Citation Articles by Chen, S. Articles by Gardner, D. G. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH