Published online before print March 29, 2004, doi: 10.1161/01.HYP.0000126068.27125.42
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2004;43:1048.)
© 2004 American Heart Association, Inc.
Scientific Contributions |
Increased O2·– Production and Upregulation of ETB Receptors by Sympathetic Neurons in DOCA-Salt Hypertensive Rats
From the Departments of Physiology (X.D., D.L.K.), Pharmacology and Toxicology (J.J.G., S.W.W., G.D.F.), and Neuroscience Program (X.D., J.J.G., G.D.F., D.L.K.), Michigan State University, East Lansing.
Correspondence to Dr David L. Kreulen, Department of Physiology, 2201 Biomedical and Physical Sciences Building, Michigan State University, East Lansing, MI 48823. E-mail dkreulen{at}msu.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Superoxide anion (O2·–) production is elevated in the vasculature of hypertensive animals but it is not known if O2·– production is also elevated in the sympathetic nervous system. We measured O2·– levels in prevertebral sympathetic ganglia of deoxycorticosterone acetate (DOCA)-salt hypertensive rats using the dihydroethidine (DHE) fluorescence method. O2·– was elevated in ganglia from DOCA-salt rats compared with normotensive sham rats. Treatment of ganglia with endothelin (ET)-1 (3x10–8 mol/L) resulted in a 200% increase in fluorescence intensity in neurons, which was attenuated by the ETB receptor antagonist BQ788 (10–7 mol/L). ET-1 also increased the O2·– induced fluorescence in dissociated sympathetic neurons and PC-12 cells via activation of ETB receptors, but not ETA receptors. To evaluate whether elevated ET-1 levels in the ganglia might contribute to the elevated O2·– found in ganglia we measured the amount of ET-1 using an ELISA assay. ET-1 levels in sham rat celiac ganglia were 695.6±40.9 picogram per gram; they were not different than ET-1 levels in ganglia from DOCA-salt rats. We then compared ETB receptor levels in ganglia from sham and DOCA-salt animals. ETB receptor mRNA levels were 32% higher and ETB receptor protein levels were 20% higher in celiac ganglia from DOCA-salt rats than from sham rats separately. In conclusion, O2·– is elevated in prevertebral sympathetic ganglia in DOCA-salt hypertension, and ET-1 is a potent stimulus for the elevation of O2·– levels in sympathetic ganglia, an effect that may be mediated by the upregulation of ETB receptors.
Key Words: endothelin • receptors, endothelin • hypertension • sympathetic nervous system • oxidative stress
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Many factors are potentially responsible for the changes that occur in the sympathetic nervous system in hypertension. In vascular tissue, there is a profound increase in reactive oxygen species (ROS), including superoxide anion (O2·–), in several models of hypertension.1,2 However, it is not known whether sympathetic neurons generate ROS, such as O2·–, and whether this is elevated in hypertension as it is in the vascular system. ROS contribute to oxidative damage and cell death in neurodegenerative diseases such as amyotropic lateral sclerosis and Parkinson disease.3 But there is no evidence of degenerative changes in sympathetic ganglia in hypertension. In the central nervous system ROS can serve as signaling molecules mediating the effects of neuroactive substances. For example, angiotensin II (Ang II)/ROS signaling system mediates the action of Ang II to increase blood pressure.4
Endothelin-1 (ET-1), a peptide originally described as a potent vasoconstrictor synthesized in endothelial cells, is also present in the nervous system and has multiple actions on sympathetic and sensory neurons.5–7 ET-1 contributes to salt-sensitive hypertension in animals and humans,8 and the pathogenesis is associated with ROS, especially O2·–, which are increased in the blood vessels in deoxycorticosterone acetate (DOCA)-salt hypertension as well as in several other experimental models of hypertension.1,2 ET-1 evokes arterial O2·– production in DOCA-salt hypertensive rats via the ETA receptors.9 The effects of ET-1 on ROS in the sympathetic nervous system, especially in hypertension, are not known.
We investigated the O2·– levels in sympathetic ganglia of DOCA-salt hypertensive rats. The focus of the present study is on the inferior mesenteric ganglia (IMG) and celiac ganglia (CG) innervating the splanchnic circulation, which stores 38% of total blood, of which up to 64% can be mobilized by the direct stimulation of sympathetic nerves due to the rich innervation.10 Due to the characteristically high ET-1 released from the endothelial cells in DOCA-salt hypertension,11,12 we examined the effects of ET receptor agonists on O2·– generation in the dissociated sympathetic postganglionic neurons and differentiated PC-12 cells with the sympathetic neuronal phenotype. We also sought to establish the possible mechanism involved in the O2·– production in sympathetic ganglia in DOCA-salt hypertension by investigating the ET-1 levels and ET receptor expression in celiac ganglia.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
An expanded Methods section can be found in an online data supplement available at http://www.hypertensionaha.org.
Animals
Animal procedures were followed in accordance with the institutional guidelines of Michigan State University. DOCA-salt hypertensive and sham rats were prepared as previously described.13 The mean arterial pressures for the DOCA-salt and sham rats were 181.3±3.1 mm Hg and 111.8±4.3 mm Hg separately.
Sympathetic Ganglia Harvest and Cell Culture
Rats were euthanized with a lethal dose of sodium pentobarbital (65 mg/kg) and the CG or the IMG were removed. CG from normal rats were cultured as previously described.14 Rat pheochromocytoma PC-12 cells were differentiated with 50 ng/mL NGF for 1 week.15
Measurement of Superoxide Anion Generation
O2·– levels were examined by measuring fluorescence signal intensity resulting from intracellular probe oxidization. IMG were from 4 groups: IMG of sham rats, IMG of DOCA-salt rats, or IMG of sham rats incubated with ET-1 or ET-1 plus the ETB receptor antagonist BQ788 (10–7 mol/L). The cells were divided into 2 treatment groups: 1 group using ET-1 (3x10–8 mol/L) as the agonist and another group using ETB receptor agonist sarafotoxin 6c (S6c, 10–8 mol/L) as the agonist. The ETA receptor antagonist BQ610 (10–7 mol/L) or the ETB receptor antagonist BQ788 was tested against both agonists. The control received no treatment. IMG or cells were loaded with the oxidant-sensitive fluorogenic probe dihydroethidine (DHE) (2 µmol/L; Molecular Probes) for 45 or 30 minutes before measuring fluorescence (excitation: 514 nm; emission: 560 nm) with a confocal microscope. The intensity of the fluorescent signal is proportional to the O2·– levels.16 Images were analyzed using ImagePro Plus software (Media Cybernetics, Inc) to measure the fluorescence intensity of individual cells. Fluorescence intensity was normalized to IMG from sham rats or control group using the same parameters.
RNA Isolation and Reverse-Transcription Polymerase Chain Reaction
Total RNA was isolated using TRIzol procedures. The cDNA was synthesized, and polymerase chain reaction (PCR) was performed. PCR amplicons were analyzed on agarose gel. The sequences of PCR primers for ETB receptor (GenBank NM_017333) were ATGACGCCACCCACTAAGAC and CACGAGGCATGATACAATCG, producing a 195bp amplicon.
Western Blotting
Tissues were homogenized and a membrane-enriched protein fraction was isolated by centrifugation. Protein concentrations were determined using the Lowry method. Protein was run in polyacrilamide gel followed by transferring to the polyvinylidene fluoride membrane. The membrane was incubated overnight with the primary ETB receptor antibody (Alomone Labs) and for 1 hour with the secondary antibody. Immunoreactivity was detected using a chemiluminescence kit.
Sympathetic ET-1 Content Measurement
CG were homogenized and immediately heated to 100°C for 10 minutes followed by chilling on ice. The homogenate was centrifuged at 14 000g for 30 minutes at 4°C. The supernatant was dried in a Speed-Vac and reconstituted in 250 µL calibrator diluent. ET-1 content was measured using the ET-1 QuantiGlo chemiluminescent assay kit (R&D Systems).
Data Analysis
Data are presented as mean±SE of the mean for the number of animals. Statistical significance was assessed by Student t test or 1-way ANOVA test with Dunnett multiple comparison post-test using Prism 3.0 software (GraphPad Software).
Drugs
ET-1, S6c, BQ610 and BQ788 were obtained from Peninsula Laboratories, and DOCA salt was purchased from Sigma Company.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Fluorogenic Detection of O2·– Levels in
Inferior Mesenteric Ganglia
Cells were grouped by diameter so that the fluorescent intensity of both neurons and glia were quantified. Cells with diameter ranging from 15 to 35 µm were identified as neurons and from 5 to 10 µm as glia. Representative optical slices through sham and DOCA-salt IMG are shown in Figure 1 (n=sham rats; n=4 DOCA-salt rats). O2·– levels were higher in the IMG from a DOCA-salt rat (Figure 1B) than from a sham rat (Figure 1A). Neurons displaying elevated O2·– levels were distributed throughout ganglia. Compared with sham ganglia, the fluorescent intensities of neurons and glia were 250% and 200% greater, respectively, in DOCA-salt ganglia (Figure 1C).
|
Effects of ET-1 Administration on O2·–
Levels in Sympathetic Ganglia
O2·– levels were evaluated in IMG of sham rats incubated with ET-1 or ET-1 plus the ETB receptor antagonist BQ788 (n=4 rats in each group). Example optical slices of control and treated ganglia are shown in Figure 2. The control sham IMG received no ET-1. O2·– levels in both neurons and glia were higher in the ET-1 treated IMG (Figure 2B) compared with the control (Figure 2A). ET-1 treatment resulted in 250% and 215% increase in fluorescent intensity in neurons and glia, respectively (Figure 2D). Ganglia pretreated with the ETB receptor antagonist BQ788 followed by ET-1 treatment showed no increase in O2·– fluorescence (Figure 2C) compared with the control (Figure 2A). This indicates that ET-1 is acting on ETB receptors to elevate O2·– levels in prevertebral sympathetic ganglia.
|
Fluorogenic Detection of O2·– Level in
Dissociated Celiac Ganglionic Neurons and PC-12 Cells
To determine whether ET-1 acts on neurons directly to elevate O2·– levels, we incubated freshly dissociated celiac ganglionic neurons from normal rats and differentiated PC-12 cells with ET-1 and measured O2·– levels. Representative confocal images of DHE fluorescence in treated cells are shown in Figure 3 and Figure 4 (n=4 dishes of cultured cells in each group). The changes in fluorescent intensity were quantified (Figure 5). Phase-contrast images of control cells are shown in Figure 3A and Figure 4A in parallel with the corresponding confocal images of control cells.
|
|
|
Compared with the control (Figure 3B, 38±4.5 arbitrary fluorescence units [AFUs]), sympathetic ganglionic cells incubated with ET-1 showed a 400% increase in fluorescence, indicating elevated O2·– levels (Figure 3C, 201±6.3 AFUs). The response was limited to cells with typical neuronal morphology with soma diameters ranging from 15 to 35 µm. Of 175 neurons counted over 4 sets of independent experiments, 174 (99.5%) were DHE positive when they were incubated with ET-1, whereas no control neurons (58 neurons counted) exhibited the fluorescence intensity above background levels. The ET-1-induced increase in the fluorescence intensity was attenuated to 45% by the pretreatment with the ETB receptor antagonist BQ788 (Figure 3E, 90±6.5 AFUs). Pretreatment of cells with the ETA receptor antagonist BQ610 did not reduce the ET-1-induced increase in the fluorescence intensity (Figure 3D, 213±9.5 AFUs). Likewise, cells treated with S6c showed a 400% increase in O2·– levels (Figure 3F, 203±5.7 AFUs). The S6c-induced increase was attenuated to 31% by the pretreatment with ETB receptor antagonist BQ788 (Figure 3H, 65±3.8 AFUs) but not by the pretreatment with BQ610 (Figure 3G, 210±8 AFUs). These experiments indicate that ETB receptors mediate superoxide anions production in sympathetic neurons.
The actions of ET receptors activation on O2·– generation were also evaluated in PC-12 cells, a catecholamine-secreting tumor cell line derived from chromaffin cells that have functional ET receptors.17 ET-1 incubation induced a 225% increase in the fluorescence intensity (Figure 4C, 192±8 AFUs) compared with control cells (Figure 4B, 59±3 AFUs). The ET-1-induced increase in the fluorescence intensity was attenuated to 40% by pretreatment with ETB receptor antagonist BQ788 (Figure 4E, 78±6 AFUs). Pretreatment with the ETA receptor antagonist BQ610 did not change the effects of ET-1 (Figure 4D, 209±8 AFUs). Cells treated with S6c showed a 270% increase in fluorescence intensity (Figure 4F, 219±6 AFUs). This increase was not blocked by BQ610 (Figure 4G, 199±4.5 AFUs) but was attenuated to 34% by the ETB receptor antagonist BQ788 (Figure 4H, 74±10 AFUs). These results indicated that ET-1 acts on the ETB receptors to induce O2·– production in PC-12 cells.
Measurement of ET-1 Levels
In the crude protein fractions extracted from CG of sham and DOCA-salt rats (n=4 sham rats; n=4 DOCA-salt rats), there were 695.6±40.9 and 723.3±71.7 picograms of ET-1 per gram of wet weight of ganglia, respectively. They were not significantly different (P>0.05).
ETB Receptor mRNA Level and Protein Expression in CG
from Sham and DOCA-Salt Hypertensive Rats
Using the primers designed stringently for the ETB receptor, reverse-transcription PCR was done in CG of sham and DOCA-salt rats (n=4 sham rats; n=4 DOCA-salt rats). The representative images are shown in Figure 6. The PCR amplicons for the ETB receptor and ß-actin were detected in CG at the expected size (195 bp and 500 bp, respectively) in 1.5% ethidium-stained agarose gel (Figure 6A). The equal densities of ß-actin bands indicate the equal loading of samples. The band densities of PCR amplicons for the ETB receptor from DOCA-salt rats were 32% higher than from sham rats (Figure 6B). This result indicates that ETB receptor mRNA levels were upregulated in CG from DOCA-salt hypertensive rats compared with sham rats.
|
Levels of ETB receptor protein were measured in CG of sham and DOCA-salt rats (n=4 sham rats; n=4 DOCA-salt rats) using Western blotting analysis. As shown in Figure 7A, a single 40KD band was present in both DOCA-salt and sham rats. The density of the ETB band was 20% higher in DOCA-salt ganglia than in sham ganglia (Figure 7B). This indicates that the ETB receptor protein expression is upregulated in sympathetic ganglia of DOCA-salt rats.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
These results provide the first evidence that O2·– levels are higher in sympathetic ganglia from DOCA-salt rats than from sham rats. Exogenous ET-1 stimulates O2·– production in the sympathetic postganglionic neurons through ETB receptor activation. While there is no difference in ET-1 levels between sympathetic ganglia from DOCA-salt rats compared with sham rats, ETB receptor mRNA and protein expression are upregulated in the sympathetic celiac ganglia from DOCA-salt rats.
Although the actions of O2·– in blood vessels have been well described, the effects of O2·– production in sympathetic ganglia are not known, nor is it known how the elevated O2·– production in sympathetic neurons of hypertension is related to the pathogenesis of hypertension. Administration of H2O2, one of the ROS, in the vicinity of sympathetic preganglionic neurons projecting to the adrenal gland results in the activation of sympathetic preganglionic neurons innervating the adrenal gland and the subsequent release of catecholamine from adrenal medulla, which in turn elevates the blood pressure and heart rate.18 This opens the possibility that a change in the redox environment of sympathetic ganglionic neurons induced by O2·– may activate sympathetic neurons and result in the vasoconstriction and hypertension. O2·– may also indirectly modulate the excitability of sympathetic neurons by several mechanisms. One possible mechanism is the ability of O2·– to modulate the sympathetic excitability by quenching or inactivating nitric oxide (NO),9 which is known to exist in the sympathetic nervous system.19 We have shown previously that NO increases a Ca++-activated K+ current in isolated sympathetic neurons, an effect that would reduce the firing rate. By causing a reduction in ganglionic NO levels, O2·– would eliminate this inhibitory effect of NO and this would result in an increased excitability of sympathetic neurons.20 Another possible mechanism is that O2·– may act as an intracellular second messenger and regulate the gene expression of antioxidant enzymes, such as SOD21 and catalase,22 in the sympathetic neurons as it does in blood vessels.23
In sympathetic ganglia from sham rats, incubation with ET-1 elevated O2·– production to the levels found in ganglia of DOCA-salt rats. Similarly, ET-1 increases intracellular O2·– production in dissociated ganglionic neurons. This demonstrates that the mechanisms responsible for ET-1 induced O2·– generation are endogenous to neuron cell bodies and do not require the presence of vasculature or glia. Sympathetic IMG neurons projecting to mesenteric arteries are distinct from neurons projecting to mesenteric veins by their localization, neurochemical phenotypes, and electrophysiological properties.14 There was no evidence that subpopulations of neurons were affected differently because the increased superoxide anion signal was evenly distributed throughout the IMG, including both ganglionic neurons and glia. Likewise, when dissociated neurons were incubated with ET-1, O2·– levels increased in all neurons. By contrast, in the central nervous system, Ang II administration increases O2·– in 40% of neurons in the lamina terminalis.4 Furthermore, it appears that the glia in sympathetic ganglia also have the capacity to generate O2·–, which is similar to the increased superoxide production mediated through NAD(P)H oxidase in microglia of the ventral mesencephalon in Parkinson disease.24
ET-1 levels in the protein extracts of celiac ganglia were the same in sham and DOCA-salt rats. In contrast, in the superior cervical ganglia of spontaneously hypertensive rats, there is an increased intracellular ET-1 immunoreactivity and mRNA.25 This may reflect different ganglia and/or different hypertensive models. ET-1 can be released from the cultured sympathetic neurons7 analogous to endothelial cells. The crude ganglionic protein extracts included intracellular and extracellular ET-1, and therefore did not differentiate between stored and released ET-1. Particularly the higher sympathetic outflow present in DOCA-salt hypertensive rats26 would result in elevated ET-1 release.
Two G-protein coupled ET-1 receptors, ETA and ETB, have been identified and cloned;27,28 both are widely distributed in vascular tissues,13 the central nervous system including neurons and glia,5,29 the sympathetic nervous system,7 and PC-12 cells.30 The activation of ET receptor subtypes may be tissue specific. Elevated O2·– production in the vasculature of DOCA-salt hypertension is mediated by ETA receptors;9 O2·– production in sympathetic ganglia, which include neurons and glia, dissociated sympathetic neurons, and PC-12 cells, is elevated by the activation of ETB receptors, but not by ETA receptors. ETA receptor knockout mice have developmental defects in the great vessels.31 By contrast, homozygous ETB receptor gene knockout mice have lethal developmental defects in the enteric nervous system.31,32 In addition, the ETB receptor is essential in neural crest development,32 from where neurons and glia of the sympathetic nervous system and the enteric nervous system are differentiated.
ETB receptor mRNA levels and protein expression were upregulated in celiac ganglia from DOCA-salt rats when compared with sham rats. Upregulation of ETB receptors also occurs in the vasculature in DOCA-salt hypertension,13 where it is thought to be important in mediating the enhanced contractile response to ET-1 that occurs in veins but not arteries. A similar mechanism may occur in ET-1-mediated increases in O2·– production in sympathetic ganglia. In the face of similar ET-1 levels in normotensive and hypertensive ganglia, upregulated ETB receptors may be mediating the enhanced O2·– production. However, the possibility of upregulated activity or mRNA expression of NAD(P)H oxidase cannot be ruled out.33 For example, Ang II upregulates vascular NAD(P)H oxidase subunits nox1, nox4, gp91phox, and p22phox mRNA expression, an effect that is thought to mediate Ang II stimulated O2·– production.34
Perspectives
This study demonstrates that O2·– is elevated in prevertebral sympathetic ganglia in DOCA-salt hypertensive rats. Furthermore, we have identified ET-1 as a stimulus to increase O2·– levels in sympathetic postganglionic neurons and PC-12 cells, and this increase can be attenuated by the specific ETB receptor antagonist BQ788 pretreatment. Finally, ET-1 may be a potent stimulus for the elevation of O2·– levels in sympathetic ganglia in DOCA-salt hypertension, an effect that is mediated by the upregulated ETB receptor pathway. We propose that O2·– production evoked by ET-1 may play roles in the increased sympathetic excitability and pathogenesis in the DOCA-salt hypertension. We further speculate that ROS in the sympathetic nervous system may be the important target for therapeutic treatment of hypertension.
|
Acknowledgments |
|---|
This study was funded by grants from the National Institutes of Health (P01HL70687) and Michigan State University to D.L.K.
Received January 28, 2004; first decision February 10, 2004; accepted February 27, 2004.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Sedeek MH, Llinas MT, Drummond H, Fortepiani L, Abram SR, Alexander BT, Reckelhoff JF, Granger JP. Role of reactive oxygen species in endothelin-induced hypertension. Hypertension. 2003; 42: 806–810.
2. Somers MJ, Mavromatis K, Galis ZS, Harrison DG. Vascular superoxide production and vasomotor function in hypertension induced by deoxycorticosterone acetate-salt. Circulation. 2000; 101: 1722–1728.
3. Pong K. Oxidative stress in neurodegenerative diseases: therapeutic implications for superoxide dismutase mimetics. Expert Opin Biol Ther. 2003; 3: 127–139.[CrossRef][Medline] [Order article via Infotrieve]
4. Zimmerman MC, Lazartigues E, Lang JA, Sinnayah P, Ahmad IM, Spitz DR, Davisson RL. Superoxide mediates the actions of angiotensin II in the central nervous system. Circ Res. 2002; 91: 1038–1045.
5. Sullivan AM, Morton AJ. Endothelins induce Fos expression in neurons and glia in organotypic cultures of rat cerebellum. J Neurochem. 1996; 67: 1409–1418.[Medline] [Order article via Infotrieve]
6. Milner P, Loesch A, Burnstock G. Endothelin immunoreactivity and mRNA expression in sensory and sympathetic neurones following selective denervation. Int J Dev Neurosci. 2000; 18: 727–734.[CrossRef][Medline] [Order article via Infotrieve]
7. Damon DH. Endothelin and post-ganglionic sympathetic neurons. Clin Exp Pharmacol Physiol. 1999; 26: 1000–1003.[CrossRef][Medline] [Order article via Infotrieve]
8. Schiffrin EL. Role of endothelin-1 in hypertension and vascular disease. Am J Hypertens. 2001; 14: 83S–89S.[CrossRef][Medline] [Order article via Infotrieve]
9. Li L, Fink GD, Watts SW, Northcott CA, Galligan JJ, Pagano PJ, Chen AF. Endothelin-1 increases vascular superoxide via endothelin(A)-NADPH oxidase pathway in low-renin hypertension. Circulation. 2003; 107: 1053–1058.
10. Greenway CV. Role of splanchnic venous system in overall cardiovascular homeostasis. FASEB J. 1983; 42: 1678–1684.
11. Yu WJ, Tomlinson B, Cheng JT. Regulation of endothelin-1 production in deoxycorticosterone acetate- salt-treated endothelial cells. Pharmacology. 2002; 64: 169–175.[Medline] [Order article via Infotrieve]
12. Millette E, de Champlain J, Lamontagne D. Contribution of endogenous endothelin in the enhanced coronary constriction in DOCA-salt hypertensive rats. J Hypertens. 2003; 21: 115–123.[CrossRef][Medline] [Order article via Infotrieve]
13. Watts SW, Fink GD, Northcott CA, Galligan JJ. Endothelin-1-induced venous contraction is maintained in DOCA-salt hypertension; studies with receptor agonists. Br J Pharmacol. 2002; 137: 69–79.[CrossRef][Medline] [Order article via Infotrieve]
14. Browning KN, Zheng ZL, Kreulen DL, Travagli RA. Two populations of sympathetic neurons project selectively to mesenteric artery or vein. Am J Physiol. 1999; 276: H1263–H1272.[Medline] [Order article via Infotrieve]
15. Greene LA, Farinelli SE, Cunningham ME, Park DS. Culture and experimental use of the PC 12 rat pheochromacytoma cell line. In: Banker G, Goslin K, eds. Culturing Nerve Cells. Cambridge, Mass: the MIT Press; 1998.
16. Becker LB, vanden Hoek TL, Shao ZH, Li CQ, Schumacker PT. Generation of superoxide in cardiomyocytes during ischemia before reperfusion. Am J Physiol. 1999; 277: H2240–H2246.[Medline] [Order article via Infotrieve]
17. Wilkes LC, Boarder MR. Characterization of the endothelin binding site on bovine adrenomedullary chromaffin cells: comparison with vascular smooth muscle cells. Evidence for receptor heterogeneity. J Pharmacol Exp Ther. 1991; 256: 628–633.
18. Lin HH, Chen CH, Hsieh WK, Chiu TH, Lai CC. Hydrogen peroxide increases the activity of rat sympathetic preganglionic neurons in vivo and in vitro. Neuroscience. 2003; 121: 641–647.[CrossRef][Medline] [Order article via Infotrieve]
19. Ceccatelli S, Lundberg JM, Zhang X, Aman K, Hokfelt T. Immunohistochemical demonstration of nitric oxide synthase in the peripheral autonomic nervous system. Brain Res. 1994; 656: 381–395.[CrossRef][Medline] [Order article via Infotrieve]
20. Browning KN, Zheng ZL, Kreulen DL, Travagli RA. Effects of nitric oxide in cultured prevertebral sympathetic ganglion neurons. J Pharmacol Exp Ther. 1998; 286: 1086–1093.
21. Park DS, Morris EJ, Stefanis L, Troy CM, Shelanski ML, Geller HM, Greene LA. Multiple pathways of neuronal death induced by DNA-damaging agents, NGF deprivation, and oxidative stress. J Neurosci. 1998; 18: 830–840.
22. Sampath D, Jackson GR, Werrbach-Perez K, Perez-Polo JR. Effects of nerve growth factor on glutathione peroxidase and catalase in PC12 cells. J Neurochem. 1994; 62: 2476–2479.[Medline] [Order article via Infotrieve]
23. Griendling KK, Sorescu D, Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res. 2000; 86: 494–501.
24. Gao HM, Liu B, Zhang W, Hong JS. Critical role of microglial NADPH oxidase-derived free radicals in the in vitro MPTP model of Parkinson’s disease. FASEB J. 2003; 17: 1954–1956.
25. Milner P, Loesch A, Burnstock G. Neural endothelin in hypertension: increased expression in ganglia and nerves to cerebral arteries of the spontaneously hypertensive rat. J Vasc Res. 2000; 37: 39–49.[CrossRef][Medline] [Order article via Infotrieve]
26. Reid JL, Zivin JA, Kopin IJ. Central and peripheral adrenergic mechanisms in the development of deoxycorticosterone-saline hypertension in rats. Circ Res. 1975; 37: 569–579.
27. Arai H, Hori S, Aramori I, Ohkubo H, Nakanishi S. Cloning and expression of a cDNA encoding an endothelin receptor. Nature. 1990; 348: 730–732.[CrossRef][Medline] [Order article via Infotrieve]
28. Sakamoto A, Yanagisawa M, Sakurai T, Takuwa Y, Yanagisawa H, Masaki T. Cloning and functional expression of human cDNA for the ETB endothelin receptor. Biochem Biophys Res Commun. 1991; 178: 656–663.[CrossRef][Medline] [Order article via Infotrieve]
29. Hama H, Sakurai T, Kasuya Y, Fujiki M, Masaki T, Goto K. Action of endothelin-1 on rat astrocytes through the ETB receptor. Biochem Biophys Res Commun. 1992; 186: 355–362.[CrossRef][Medline] [Order article via Infotrieve]
30. Watanabe K, Hiraki H, Hasegawa H, Tanigawa T, Emura I, Honma K, Shibuya H, Fukuda T, Suzuki T. Immunohistochemical localization of endothelin-1, endothelin-3 and endothelin receptors in human pheochromocytoma and paraganglioma. Pathol Int. 1997; 47: 540–546.[Medline] [Order article via Infotrieve]
31. Kurihara H, Kurihara Y, Nagai R, Yazaki Y. Endothelin and neural crest development. Cell Mol Biol (Noisy -le-grand). 1999; 45: 639–651.[Medline] [Order article via Infotrieve]
32. Gershon MD. Neural crest development. Do developing enteric neurons need endothelins? Curr Biol. 1995; 5: 601–604.[CrossRef][Medline] [Order article via Infotrieve]
33. Fukui T, Ishizaka N, Rajagopalan S, Laursen JB, Capers Q, Taylor WR, Harrison DG, de Leon H, Wilcox JN, Griendling KK. p22phox mRNA expression and NADPH oxidase activity are increased in aortas from hypertensive rats. Circ Res. 1997; 80: 45–51.
34. Higashi M, Shimokawa H, Hattori T, Hiroki J, Mukai Y, Morikawa K, Ichiki T, Takahashi S, Takeshita A. Long-term inhibition of Rho-kinase suppresses angiotensin II-induced cardiovascular hypertrophy in rats in vivo: effect on endothelial NAD(P)H oxidase system. Circ Res. 2003; 93: 767–775.
This article has been cited by other articles:
 |
|
 |
|
  M. J. P. M. T. Meens, G. E. Fazzi, M. A. van Zandvoort, and J. G. R. De Mey Calcitonin Gene-Related Peptide Selectively Relaxes Contractile Responses to Endothelin-1 in Rat Mesenteric Resistance Arteries J. Pharmacol. Exp. Ther., October 1, 2009; 331(1): 87 - 95. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Lavie and P. Lavie Molecular mechanisms of cardiovascular disease in OSAHS: the oxidative stress link Eur. Respir. J., June 1, 2009; 33(6): 1467 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Li, X. Dai, S. Watts, D. Kreulen, and G. Fink Increased superoxide levels in ganglia and sympathoexcitation are involved in sarafotoxin 6c-induced hypertension Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1546 - R1554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Just, C. L. Whitten, and W. J. Arendshorst Reactive oxygen species participate in acute renal vasoconstrictor responses induced by ETA and ETB receptors Am J Physiol Renal Physiol, April 1, 2008; 294(4): F719 - F728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Cao, X. Dai, L. M. Parker, and D. L. Kreulen Differential Regulation of NADPH Oxidase in Sympathetic and Sensory Ganglia in Deoxycorticosterone Acetate Salt Hypertension Hypertension, October 1, 2007; 50(4): 663 - 671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Chapleau The Continuing Saga of Neuronal Oxidative Stress in Hypertension: Nox, Nox Who's There, and Where? Hypertension, October 1, 2007; 50(4): 600 - 602. [Full Text] [PDF]
|
|
|
|
|
|
S. K. Fellner and W. Arendshorst Endothelin-A and -B receptors, superoxide, and Ca2+ signaling in afferent arterioles Am J Physiol Renal Physiol, January 1, 2007; 292(1): F175 - F184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-F. Lai, V. Seshadri, K. Huang, J.-S. Shao, J. Cai, R. Vattikuti, A. Schumacher, A. P. Loewy, D. T. Denhardt, S. R. Rittling, et al. An Osteopontin-NADPH Oxidase Signaling Cascade Promotes Pro-Matrix Metalloproteinase 9 Activation in Aortic Mesenchymal Cells Circ. Res., June 23, 2006; 98(12): 1479 - 1489. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Dai, X. Cao, and D. L. Kreulen Superoxide anion is elevated in sympathetic neurons in DOCA-salt hypertension via activation of NADPH oxidase Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1019 - H1026. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Wilcox Special feature: cardiovascular-kidney interactions in health and disease Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R34 - R36. [Full Text] [PDF]
|
|
|
|
|
|
Y. E. Lau, J. J. Galligan, D. L. Kreulen, and G. D. Fink Activation of ETB receptors increases superoxide levels in sympathetic ganglia in vivo Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R90 - R95. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Loomis, J. C. Sullivan, D. A. Osmond, D. M. Pollock, and J. S. Pollock Endothelin Mediates Superoxide Production and Vasoconstriction through Activation of NADPH Oxidase and Uncoupled Nitric-Oxide Synthase in the Rat Aorta J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1058 - 1064. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||