| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2005;45:133.)
© 2005 American Heart Association, Inc.
Scientific Contributions |
From the Department of Medicine, University of Virginia Health System, Charlottesville, Va.
Correspondence to Helmy M. Siragy, MD, Department of Medicine, University of Virginia Health Science Center, 450 Ray C Hunt Drive Charlottesville, VA 22903. E-mail hms7a{at}virginia.edu
| Abstract |
|---|
|
|
|---|
41% and 29% from LS, respectively. Renin mRNA increased 63% during LS, and either valsartan or PD increased it further by 600% and 250% from NS and 538% and 187% from LS, respectively. Similarly, renal renin content and PRC increased in response to LS and increased further in response to combined LS and valsartan or PD administration. Immunostaining for renal renin protein demonstrated an increase in its expression in juxtaglomular and tubular cells during LS and increased further during AT1 or AT2 receptor blockade. These data demonstrate for the first time to our knowledge that AT2 receptors regulate the renin-angiotensin system activity via inhibition of renin synthesis.
Key Words: receptors, angiotensin II renin kidney angiotensin
| Introduction |
|---|
|
|
|---|
In this study, we tested the hypothesis that the AT2 receptor inhibits renal renin synthesis and Ang II production. We used multiple techniques including renal interstitial microdialysis,1317 real-time quantitative reverse-transcription polymerase chain reaction, immunohistochemistry, and enzyme-linked immunoassays for monitoring changes in renal Ang II, renin mRNA, renin protein expression, and plasma renin concentration to investigate whether intrarenal AT2 receptors regulate renin production and Ang II formation. We monitored renal interstitial levels of Ang II in conscious rats during sodium restriction, a condition known to increase AT2 receptor expression, and during AT1 and AT2 receptor blockade.5 A distinct advantage of the microdialysis technique13 is the ability to monitor renal Ang II levels in conscious rats without undesirable hemodynamic changes. In this study, we demonstrate for the first time to our knowledge that AT2 receptors regulate the activity of the RAS through inhibition of renin biosynthesis in young rats.
| Methods |
|---|
|
|
|---|
53%. A negligible amount of Ang II sticks to the polyethylene tubes of the dialysis probes, as demonstrated by the in vitro recovery of [131I]Ang II at 99.8%.1520
Animal Preparation
The experiments were approved by the University of Virginia Animal Research Committee and conducted in accordance with institutional guidelines. Experiments were conducted in 4-week-old female SpragueDawley rats (n=8 in each group; Harlan Teklad, Madison, Wis). For collecting RIF, the microdialysis probe was inserted in the kidney as previously described.1317 For infusions into the renal cortical interstitial space, a 10-cm-long polyethylene tube (PE 60; Becton Dickinson, Sparks, Md) was inserted into the right renal cortex as previously described.21 The interstitial infusion rate was determined from preliminary studies and is optimum at 5 µL/min (a rate that ensures distribution of the infused substance to the entire renal cortex without dislodging the catheter from the kidney). To demonstrate renal distribution of interstitially infused substances, using florescence microscopy we were able to localize florescence-labeled Ang II in the renal cortex. Rats were housed under controlled conditions (temperature: 21±1°C; humidity: 60±10%; lighting 8 to 20 hours) and allowed 7 days to recover and to acclimatize to the laboratory. Experiments were started at the same time (8:00 AM) each day to avoid any diurnal variation of the measured substances. During the first and last 30 minutes of each study, systolic arterial pressure was measured every 10 minutes in the rat tail (Rat Tail Manometer-Tachometer System, Natsume model KN-210; Peninsula Laboratories, Inc, Belmont, Calif) and the recorded values were averaged for each study.
Effects of Sodium Depletion and Angiotensin AT1 or AT2 Receptor Blockade on RIF Ang II
In this study, rats (n=8 each group) were placed in metabolic cages. Baseline 24-hour urine collections were obtained for calculation of urinary sodium excretion, and RIF samples were obtained for Ang II while rats were consuming a normal sodium diet (0.28% NaCl; BioServe Biotechnologies, Frenchtown, NJ). Then, rats were placed on a low-sodium diet (0.05% NaCl) for 8 days. At day 7, we monitored 24-hour urinary sodium excretion (UNaV). While the rats continued to consume the low-sodium diet (day 8), RIF Ang II levels were monitored during intrarenal cortical interstitial administration (5 µL/min for 8 hours) in random order of D5W vehicle (n=8), PD 123319 (n=8; Parke-Davis-Warner Lambert Co, Ann Arbor, Mich), a specific AT2 receptor antagonist,22,23 or the AT1 receptor blocker, valsartan (n=8; Novartis, East Hanover). PD was infused at 10 µg/kg per minute for 8 hours (a dose that remains highly specific for AT2 receptor), whereas the dose for valsartan was 10 mg/kg per 8 hours.
Renal Renin mRNA, Protein Expression, Renin Concentration and Ang II, and Plasma Renin Concentration in Response to AT1 or AT2 Receptor Blockade
At the end of each protocol, animals were euthanized and blood was collected in tubes containing EDTA for measurement of plasma renin concentration. The infused kidneys were removed, placed on ice, and divided into sections for RNA extraction, total renin and Ang II measurements, and renin immunostaining.
Quantitative Real-Time ReverseTranscriptionPolymerase Chain Reaction
The kidney tissue was weighted promptly and homogenized on ice, and the total renal RNA was extracted using RNeasy Kit (Qiagen, Gumbh, Hilden, Germany). Quality of RNA is confirmed by ethidium bromide staining in 2% agarose gel. Single-stranded cDNA is synthesized using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, Calif). Gene-specific renin primers are designed using the Gene Bank. The exonintron boundaries are determined using the University of California Santa Cruz Genome Bioinformatics Site (http://genome.ucsc.edu). The left primer is 5' gaggcagtgaccctcaacat 3', and right primer is 5' ccctcctcacacaacaaggt 3'. The corresponding cDNA product size is 124 bp. Amplification products are verified by melting curves. Quantitative real-time polymerase chain reaction is performed using iCycler (Bio-Rad, Hercules, Calif) and threshold cycle number is determined using iCycler software version 3.0 (Bio-Rad). Reactions are performed in triplicate, and threshold cycle numbers are averaged. Nontemplate control was used as a negative control. Samples are calculated with normalization to actin. Fold down-expression or up-expression is calculated according to the formula 2(RtEt)/2(RnEn), where Rt is the threshold cycle number for the reference gene observed in the test sample, Et is the threshold cycle number for the experimental gene observed in the test sample, Rn is the threshold cycle number for the reference gene observed in the control sample, and Rt is the threshold cycle number for the experimental gene observed in the test sample.
Renin Immunohistochemistry
Kidney tissues were fixed in Bouin solution and embedded in paraffin. Six-micrometer sections were stained for renin using a previously characterized polyclonal goat anti-rat renin antibody24 (a gift from Dr Tadashi Inagami at the Vanderbilt University), avidin-biotin-peroxidase (Vectastain ABC kit; Vector Laboratories, Burlingame, Calif), and methods described previously.25 Negative controls included omission of primary and secondary antibodies.
The aforementioned studies were repeated in another group of animals during normal sodium intake. Renal renin mRNA, renin protein expression, protein expression and total renin concentration were monitored in response to AT1 or AT2 receptor blockade.
Analytical Methods
Urinary sodium levels were measured by a NOVA analyzer (NOVA Biomedical; Waltham, Mass). RIF samples for Ang II underwent sample extraction followed by RIA.15 Total renal renin26 and Ang II content15,27 were measured according to previously published methods.
Statistical Analysis
Comparisons among different treatment groups were examined by ANOVA, including a repeated measure term, using the general linear models procedure of the Statistical Analysis System (SAS Software, SAS Institute, Cary, NC). Data are expressed as mean±SE. P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
RIF Ang II Responses to Low Sodium Intake Alone and Combined With Intrarenal Administration of Valsartan or PD
RIF Ang II levels (Figure 1A) during normal sodium intake were 2±0.2 fmol/mL (n=8) and increased during dietary sodium restriction to 96±1.5 fmol/mL (P<0.00001). Intrarenal cortical administration of valsartan or PD (n=8 each treatment) during low sodium intake caused a further increase in RIF Ang II to 136±2 and 124±2 fmol/mL, respectively (P<0.00001 from normal sodium and P<0.0001 from low sodium intake).
|
Total Renal Ang II Content in Response to Low Sodium Intake Alone and Combined With Intrarenal Administration of Valsartan or PD
During normal sodium intake (n=8), total renal Ang II content was 164±16 fmol/g kidney weight (Figure 1B). Low sodium intake (n=8) increased renal Ang II content to 338±49 fmol/g kidney weight (P<0.0001). Intrarenal cortical administration of valsartan caused significant increase in total renal Ang II (1160±140 fmol/g kidney weight) compared with normal (P<0.0001) and low-sodium (P<0.01) diet. Similarly, during low sodium intake, PD (n=8) caused further increase in total renal Ang II content to 1024±160 fmol/g kidney weight (P<0.0001 from normal sodium and P<0.01 from low sodium).
Renal Renin mRNA and Total Renal Renin Content Response to Low Sodium Intake Alone and Combined With Intrarenal Administration of Valsartan or PD
During normal sodium intake, the levels of the renal renin mRNA and total renin content were very low and did not change in response to valsartan or PD treatment (data not shown). Renal renin mRNA (n=8) increased significantly by
80% (P<0.0001) in response to low sodium intake (Figure 2A). Intrarenal cortical administration of valsartan (n=8) or PD (n=8) during low sodium intake caused further increase in renal renin mRNA (620% and 250%, respectively) compared with normal (P<0.0001) and low (P<0.0001) sodium intake. During normal sodium intake, total renal renin content (Figure 2B) was 30±5 µg/g kidney tissue (n=8) and increased to 150±3 µg/g kidney tissue per hour (P<0.0001) in response to low sodium intake (n=8). Intrarenal cortical administration of valsartan (n=8) or PD (n=8) during low sodium intake caused a further increase (313±10 and 344±12 µ/g kidney weight, respectively) in total renal renin content (P<0.0001 compared with normal or low sodium intake).
|
Renal Renin Immunostaining in Response to Low Sodium Intake Alone and Combined With Intrarenal Administration of Valsartan or PD
There was no renin staining when IGg preimmune was used as control (Figure 3A and 3F). During normal sodium intake (Figure 3B and 3G), renin immunostaining was very low, localized mainly in the juxtaglomerular apparatus, and did not change in response to valsartan or PD treatment (data not shown). Low sodium intake (Figure 3C and 3H) caused significant increase in renin immunostaining in the glomeruli and juxtaglomerular apparatus. Combined low salt intake with valsartan (Figure 3D and 3I) or PD (Figure 3E and 3J) caused further increase in renin staining in glomeruli, juxtaglomerular apparatus, and tubules compared with normal (Figure 3B and 3G) and low salt (Figure 3C and 3H) intake alone.
|
Plasma Renin Concentration in Response to Low Sodium Intake Alone and Combined With Intrarenal Administration of Valsartan or PD
During normal sodium intake, plasma renin concentration levels (Figure 4) were 10±1.1 ng/mL and increased in response to low sodium intake to 25±4.2 ng/mL (P<0.01). Plasma renin concentration increased further to 62±12.2 and 48±11.4 ng/mL during combined low sodium intake and valsartan or PD treatment, respectively (P<0.0001 from normal sodium intake and P<0.01 from low sodium intake).
|
| Discussion |
|---|
|
|
|---|
All the components of the RAS are present within the kidney and local renal production of Ang II has been demonstrated.20 Renin is the rate-limiting enzyme in the synthesis of Ang II.30 In addition to juxtaglomerular cells, renin is produced by mesangial31 and tubular32 cells. Angiotensinogen and angiotensin-converting enzyme are generated within the kidney.30 AT1 and AT2 receptors are also located within the kidney.28 In particular, AT2 receptors are present in juxtaglomerular cells and have been shown to inhibit prorenin processing.33
Previously published data demonstrated a short negative feedback loop of the AT1 receptor to suppress renin and Ang II production.1,18,19 A regulatory role for the AT2 receptor in modulating RAS activity has not been described previously. A murine strain with disruption of the AT2 receptor gene displays slightly elevated baseline blood pressure, exaggerated vasopressor response to Ang II, increased prostaglandin E2 (PGE2), and reduced NO and cGMP production.16 In those studies, systemic or renal tissue renin or Ang II levels were not evaluated. In a renal vascular hypertension rat model,15 AT2 receptor blockade caused further increase in blood pressure. Taken together, current and previous data suggest that the AT2 receptor regulates the RAS either directly or through multiple mechanisms involving NO, cGMP, or PGE2.
The increase in Ang II in parallel to the increase in renin mRNA, renin protein, and plasma renin concentration suggests that the AT2 receptor regulates the RAS mainly through increased production of renin. The current study cannot differentiate whether the increase in the activity of the RAS is directly linked to decreased AT2 receptor activity or is directly linked to reduction in its mediator NO and cGMP. The influence of NO is controversial, with studies showing stimulation,34,35 inhibition,36 or no direct influence3739 on renin production. Cyclic GMP has been shown to inhibit renin expression and secretion.40 Activation of cGMP-dependent protein kinases by cGMP decreased renin secretion from the isolated perfused rat kidney, isolated renal juxtaglomerular cells, and kidney slices.4042 PGE2 enhances renin production43 through stimulation of EP3 and EP4 receptors. Absence of AT2 receptor activity increases renal PGE2 levels through enhancing the activity of AT1 receptor13,16 or decreasing the metabolism of PGE2 to 6-ketoPGF1
.44 Thus, our previous finding of AT2 receptor mediation of NO,14 cGMP,13 and PGE213,16 production supports conclusion that this receptor regulation of renin production, at least in young animals.
Absence of PD effects on renin synthesis and secretion during normal sodium intake, a condition associated with low AT2 receptor expression,5 strengthens the argument for its involvement in renin regulation. Previous studies demonstrated that AT1 and AT2 receptors counterbalance each other.28 The current study demonstrates a rare instance in which both of these receptors share a similar function.
Perspectives
This study introduces the novel concept of AT2 receptor regulation of the RAS activity. Development of an AT2 receptor agonist could help provide a pharmacological tool for further RAS inhibition, in addition to angiotensin-converting enzyme and AT1 receptor blockers, to manage cardiovascular disease.
| Acknowledgments |
|---|
Received August 9, 2004; first decision August 17, 2004; accepted October 19, 2004.
| References |
|---|
|
|
|---|
2. Horiuchi M, Akishita M, Dzau VJ. Recent progress in angiotensin II type-2 receptor research in the cardiovascular system. Hypertension. 1999; 33: 613621.
3. Grady EF, Sechi LA, Griffin CA, Schambelan M, Kalinyak JE. Expression of AT2 receptor in the developing rat fetus. J Clin Invest. 1991; 88: 921933.[Medline] [Order article via Infotrieve]
4. Tanabe A, Naruse M, Arai K, Naruse K, Yoshimoto T, Seki T, Imaki T, Miyaazake H, Zeng ZP, Demura R, Demura H. Gene expression and roles of angiotensin II type 1 and type 2 receptors in human adrenals. Horm Metab Res. 1998; 30: 490495.[Medline] [Order article via Infotrieve]
5. Ozono R, Wang ZQ, Moore AF, Siragy HM, Carey RM. Expression of subtype-2 (AT2) angiotensin receptor protein in the rat kidney. Hypertension. 1997; 30: 12381246.
6. Wang ZQ, Moore AF, Ozono R, Siragy HM, Carey RM. Immunolocalization of subtype-2 angiotensin II (AT2) receptor protein in the rat heart. Hypertension. 1998; 32: 7883.
7. Meffer S, Stroll M, Steckelings UM, Bottari SP, Metzger R, Unger T. The angiotensin AT2 receptor inhibits proliferation and promotes differentiation in PC12W cells. Mol Cell Endocrinol. 1996; 122: 5967.[CrossRef][Medline] [Order article via Infotrieve]
8. Stoll M, Steckelings UM, Paul M, Battari SP, Metzger R, Unger T. The angiotensin AT2 receptor mediates inhibition of cell proliferation in coronary endothelial cells. J Clin Invest. 1995; 95: 651657.[Medline] [Order article via Infotrieve]
9. Maric C, Aldred GP, Harris PJ, Alcorn D. Angiotensin II inhibits growth of cultured embryonic renomedullary interstitial cells through the AT2 receptor. Kidney Int. 1998; 53: 9296.[CrossRef][Medline] [Order article via Infotrieve]
10. Kuizinga MC, Smits JFM, Arends JW, Daemen MJAP. AT2 receptor blockade reduce cardiac cell DNA synthesis and cardiac function after rat myocardial infarction. J Mol Cell Cardiol. 1998; 30: 425434.[CrossRef][Medline] [Order article via Infotrieve]
11. Goodfriend TL, Elliot ME, Catt KJ. Angiotensin receptors and their antagonists. N Engl J Med. 1996; 334: 16491654.
12. Griendling KK, Lassegue B, Alexander RW. Angiotensin receptor and their therapeutic implications. Ann Rev Pharmacol Toxicol. 1996; 10: S30S39.
13. Siragy HM, Carey RM. The subtype-2 (AT2) receptor regulates renal cyclic GMP and AT1 receptor-mediated PGE production in conscious rats. J Clin Invest. 1996; 97: 19781982.[Medline] [Order article via Infotrieve]
14. Siragy HM, Carey RM. The subtype-2 (AT2) receptor mediates renal production of nitric oxide in conscious rats. J Clin Invest. 1997; 100: 264269.[Medline] [Order article via Infotrieve]
15. Siragy HM, Carey RM. Protective role of the angiotensin AT2 receptor in a renal wrap hypertension model. Hypertension. 1999; 103: 167174.
16. Siragy HM, Inagami T, Ichiki T, Carey RM. Sustained hypersensitivity to angiotensin II and its mechanism in mice lacking the subtype-2 (AT2) angiotensin receptor. Proc Natl Acad Sci U S A. 1999; 96: 65056510.
17. Siragy HM, de Gasparo M, Carey RM. Angiotensin type 2 receptor mediates valsartan-induced hypotension in conscious rats. Hypertension. 2000; 35: 10741077.
18. Kurtz A, Wagner C. Regulation of renin secretion by angiotensin II-AT1 receptor. J Am Soc Nephrol. 1999; 11: 162168.
19. Tanabe A, Naruse M, Naruse K, Ito F, Yoshimoto T, Seki T, Demura R, Demura H, Toma H, Inagami T. Angiotensin II type 1 receptor expression in two cases of juxtaglomerular cell tumor: correlation to negative feedback of renin secretion by angiotensin II. Horm Metab Res. 1999; 31: 429434.[Medline] [Order article via Infotrieve]
20. Siragy HM, Howell N, Ragsdale NV, Carey RM. Renal interstitial fluid angiotensin. Modulation by anesthesia, epinephrine, sodium depletion, and renin inhibition. Hypertension. 1995; 25: 10211024.
21. Jin X-H, McGrath HE, Gildea JJ, Siragy HM, Felder RA, Carey RM. Renal interstitial guanosine cyclic 3',5'-monophosphate mediates pressure-natriuresis via protein kinase G. Hypertension. 2004; 43: 11331139.
22. Lo M, Liu K, Lantelme P, Sassard J. Subtype 2 of angiotensin II receptors controls pressure-natriuresis in rats. J Clin Invest. 1995; 95: 1394.[Medline] [Order article via Infotrieve]
23. Dudley DT, Panek RL, Major TC, Lu GH, Bruns RF, Klinkeful BA, Hodges JC, Weishaar RE. Subclasses of angiotensin II binding sites and their function significance. Mol Pharmacol. 1990; 38: 370377.[Abstract]
24. Niimura F, Labosky PA, Kakuchi J, Okubo S, Yoshida H, Oikawa T, Ichiki T, Naftilan AJ, Fogo A, Inagami T, Hogan BLM, Ichikawa I. Gene targeting in mice reveals a requirement for angiotensin in the development and maintenance of kidney morphology and growth factor regulation. J Clin Invest. 1995; 96: 29472954.[Medline] [Order article via Infotrieve]
25. Gomez RA, Lynch KR, Sturgill BC, Elwood JP, Chevalier RL, Carey RM, Peach MJ. Distribution of renin mRNA and its protein in the developing kidney. Am J Physiol. 1989; 257: F850F858.[Medline] [Order article via Infotrieve]
26. Sealey JE, Laragh J. How to do a plasma renin assay. Cardiovasc Med. 1979; 2: 10791092.
27. Siragy HM, Awad A, Abadir P, Webb R. The angiotensin II type 1 receptor mediates renal interstitial content of tumor necrosis factor-alpha in diabetic rats. Endocrinology. 2003; 144: 22292233.
28. Siragy HM. AT1 and AT2 receptor in the kidney: role in health and disease. Semin Nephrol. 2004; 24: 93100.[CrossRef][Medline] [Order article via Infotrieve]
29. De Gasparo M, Whitebread S, Bottari SP, Levens N. Heterogencity of the angiotensin receptor subtypes. In: Timmermans PB, Wexler RR, eds. Medicine Chemistry of the renin angiotensin receptor subtypes. Elsevier, Lausanne; 1994: 269.
30. Brewster UC, Perazella MA. The renin-angiotensin-aldosterone system and the kidney: effects on kidney disease. Am J Med. 2004; 116: 263272.[CrossRef][Medline] [Order article via Infotrieve]
31. Vidotti DB, Casarini DE, Cristovan PC, Leite CA, Schor N, Boim MA. High glucose concentration stimulates intracellular renin activity and angiotensin II generation in rat mesangial cells. Am J Physiol. 2004; 285: F1039F1045.
32. Moe OW, Ujiie K, Star RA, Miller RT, Widell J, Alpern RJ, Henrich WL. Renin expression in renal proximal tubule. J Clin Invest. 1993; 91: 774779.[Medline] [Order article via Infotrieve]
33. Ichihara A, Hayashi M, Hirota N, Okada H, Koura Y, Tada Y, Kaneshiro Y, Tsuganezawa H, Saruta T. Angiotensin II type 2 receptor inhibits prorenin processing in juxtaglomerular cells. Hypertens Res. 2003; 26: 915921.[CrossRef][Medline] [Order article via Infotrieve]
34. Schricker K, Hamann M, Kurtz A. Nitric oxide and prostaglandins are involved in the macula densa control of the renin system. Am J Physiol. 1995; 269: F825F830.[Medline] [Order article via Infotrieve]
35. Kurtz A, Gotz KH, Hamann M, Wagner C. Stimulation of renin secretion by nitric oxide is mediated by phosphodiesterase 3. Proc Natl Acad Sci U S A. 1998; 95: 47434747.
36. Schnackenberg CG, Tabor BL, Strong MH, Granger JP. Inhibition of intrarenal NO stimulates renin secretion through a macula densa-mediated mechanism. Am J Physiol. 1997; 272: R879R886.[Medline] [Order article via Infotrieve]
37. Castrop H, Schweda F, Mizel D, Huang Y, Briggs J, Kurtz A, Schnermann J. Permissive role of nitric oxide in macula densa control of renin secretion. Am J Physiol. 2004; 286: F848F857.
38. Wagner C, Godecke A, Ford M, Schnermann J, Schrader J, Kurtz A. Regulation of renin gene expression in kidneys of eNOS- and nNOS-deficient mice. Pflugers Arch. 2000; 439: 67572.[CrossRef]
39. Beierwaltes WH, Potter DL, Shesely EG. Renal baroreceptor-stimulated renin in the eNOS knockout mouse. Am J Physiol. 2002; 282: F59F64.
40. Wagner C, Pfeifer A, Ruth P, Hofmann F, Kurtz A. Role of cGMP-kinase II in the control of renin secretion and renin expression. J Clin Invest. 1998; 102: 15761582.[Medline] [Order article via Infotrieve]
41. Kurtz A, Della Bruna R, Pfeilschifter J, Taugner R, Bauer C. Atrial natriuretic peptide inhibits renin release from isolated renal juxtaglomerular cells by a cGMP mediated process. Proc Natl Acad Sci U S A. 1986; 83: 47694773.
42. Henrich WL, McAllister EA, Smith PB, Campbell WB. Guanosine 3', 5'cylic monophosphate as a mediator of inhibition of renin release. Am J Physiol. 1988; 255: 474478.
43. Schweda F, Klar J, Narumiya S, Nusing RM, Kurtz A. Stimulation of renin release by prostaglandin E2 is mediated by EP2 and EP4 receptors in mouse kidneys. Am J Physiol. 2004; 287: F427F433.
44. Siragy HM, Carey RM. The subtype 2 angiotensin receptor regulates renal prostaglandin F2 alpha formation in conscious rats. Am J Physiol. 1997; 273: R1103R1107.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. Yvan-Charvet, F. Massiera, N. Lamande, G. Ailhaud, M. Teboul, N. Moustaid-Moussa, J.-M. Gasc, and A. Quignard-Boulange Deficiency of Angiotensin Type 2 Receptor Rescues Obesity But Not Hypertension Induced by Overexpression of Angiotensinogen in Adipose Tissue Endocrinology, March 1, 2009; 150(3): 1421 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Siddiqui, Q. Ali, and T. Hussain Protective Role of Angiotensin II Subtype 2 Receptor in Blood Pressure Increase in Obese Zucker Rats Hypertension, February 1, 2009; 53(2): 256 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Abdel-Rahman, P. M. Abadir, and H. M. Siragy Regulation of renal 12(S)-hydroxyeicosatetraenoic acid in diabetes by angiotensin AT1 and AT2 receptors Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1473 - R1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roberge, A. C. Carpentier, M.-F. Langlois, J.-P. Baillargeon, J.-L. Ardilouze, P. Maheux, and N. Gallo-Payet Adrenocortical dysregulation as a major player in insulin resistance and onset of obesity Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1465 - E1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Siragy Angiotensin AT1 and AT2 receptors the battle for health and disease Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3128 - 3130. [Full Text] [PDF] |
||||
![]() |
H. M. Siragy, T. Inagami, and R. M. Carey NO and cGMP mediate angiotensin AT2 receptor-induced renal renin inhibition in young rats Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1461 - R1467. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Azizi, J. Menard, A. Bissery, T.-T. Guyene, and A. Bura-Riviere Hormonal and Hemodynamic Effects of Aliskiren and Valsartan and Their Combination in Sodium-Replete Normotensive Individuals Clin. J. Am. Soc. Nephrol., September 1, 2007; 2(5): 947 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Coleman, J. J. Minor, L. E. Burt, B. A. Thornhill, M. S. Forbes, and R. L. Chevalier Angiotensin AT1-receptor inhibition exacerbates renal injury resulting from partial unilateral ureteral obstruction in the neonatal rat Am J Physiol Renal Physiol, July 1, 2007; 293(1): F262 - F268. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Vongpatanasin, G. D. Thomas, R. Schwartz, L. A. Cassis, S. Osborne-Lawrence, L. Hahner, L. L. Gibson, S. Black, D. Samols, and P. W. Shaul C-Reactive Protein Causes Downregulation of Vascular Angiotensin Subtype 2 Receptors and Systolic Hypertension in Mice Circulation, February 27, 2007; 115(8): 1020 - 1028. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Salomone, N. L. Howell, H. E. McGrath, B. A. Kemp, S. R. Keller, J. J. Gildea, R. A. Felder, and R. M. Carey Intrarenal Dopamine D1-Like Receptor Stimulation Induces Natriuresis via an Angiotensin Type-2 Receptor Mechanism Hypertension, January 1, 2007; 49(1): 155 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Barker, M. P. Massett, V. A. Korshunov, A. M. Mohan, A. J. Kennedy, and B. C. Berk Angiotensin II Type 2 Receptor Expression After Vascular Injury: Differing Effects of Angiotensin-Converting Enzyme Inhibition and Angiotensin Receptor Blockade Hypertension, November 1, 2006; 48(5): 942 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Muller and F. C. Luft Direct Renin Inhibition with Aliskiren in Hypertension and Target Organ Damage Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 221 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xue and H. M. Siragy Local Renal Aldosterone System and Its Regulation by Salt, Diabetes, and Angiotensin II Type 1 Receptor Hypertension, September 1, 2005; 46(3): 584 - 590. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |