Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2005;45:356-362
Published online before print January 3, 2005, doi: 10.1161/01.HYP.0000154361.47683.d3
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
45/3/356    most recent
01.HYP.0000154361.47683.d3v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Engeli, S.
Right arrow Articles by Sharma, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Engeli, S.
Right arrow Articles by Sharma, A. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity
*Weight Control
Related Collections
Right arrow Obesity
Right arrow ACE/Angiotension receptors
Right arrow Gene expression
Right arrow Other Treatment

(Hypertension. 2005;45:356.)
© 2005 American Heart Association, Inc.


Original Articles

Weight Loss and the Renin-Angiotensin-Aldosterone System

Stefan Engeli; Jana Böhnke; Kerstin Gorzelniak; Jürgen Janke; Petra Schling; Michael Bader; Friedrich C. Luft; Arya M. Sharma

From Medical Faculty of the Charité (S.E., J.B., K.G., J.J., M.B., F.C.L.), Franz Volhard Clinic and Max Delbrück Center for Molecular Medicine, HELIOS-Klinikum, Berlin, Germany; Institute for Clinical Chemistry and Laboratory Medicine (P.S.), University of Regensburg, Germany; Department of Medicine (A.M.S.), McMaster University, Hamilton, Ontario, Canada.

Correspondence to Stefan Engeli, MD, Franz-Volhard-Klinik (Haus 129), Wiltbergstraße 50, 13125 Berlin, Germany. E-mail engeli{at}fvk.charite-buch.de

Abstract

The renin-angiotensin-aldosterone system has been causally implicated in obesity-associated hypertension. We studied the influence of obesity and weight reduction on the circulating and adipose tissue renin-angiotensin-aldosterone system in menopausal women. Blood samples were analyzed for angiotensinogen, renin, aldosterone, angiotensin-converting enzyme activity, and angiotensin II. In adipose tissue biopsy samples, we analyzed angiotensinogen, renin, renin-receptor, angiotensin-converting enzyme, and angiotensin II type-1 receptor gene expression. Obese women (n=19) had higher circulating angiotensinogen, renin, aldosterone, and angiotensin-converting enzyme than lean women (n=19), and lower angiotensinogen gene expression in adipose tissue. Seventeen women successfully participated in a weight reduction protocol over 13 weeks to reduce daily caloric intake by 600 kcal. Body weight was reduced by –5%, as were angiotensinogen levels by –27%, renin by –43%, aldosterone by –31%, angiotensin-converting enzyme activity by –12%, and angiotensinogen expression by –20% in adipose tissue (all P<0.05). The plasma angiotensinogen decrease was highly correlated with the waist circumference decline (r=0.74; P<0.001). Weight and renin-angiotensin-aldosterone system reductions were accompanied by a –7-mm Hg reduced systolic ambulatory blood pressure. These data suggest that a 5% reduction in body weight can lead to a meaningfully reduced renin-angiotensin-aldosterone system in plasma and adipose tissue, which may contribute to the reduced blood pressure.


Key Words: adipose tissue • aldosterone • angiotensinogen • hypertension • obesity • renin

Obesity leads to hypertension and increased cardiovascular risk.1,2 The renin-angiotensin-aldosterone system (RAAS) has been implicated by several authors.3 In humans, increased circulating angiotensinogen (AGT), renin, aldosterone, and angiotensin-converting enzyme (ACE) activity were reported in obese subjects.4–10 Furthermore, increased RAAS gene expression was described in adipose tissue, especially in rodent models of obesity.3,11–15 The link between adipose tissue AGT gene expression and blood pressure was recently documented in 2 mouse models. Targeted AGT expression in adipocytes of wild-type and AGT knockout mice increased circulating AGT levels and blood pressure.16 Targeted expression of 11ß-hydroxysteroid dehydrogenase-1 in adipocytes increased blood pressure, plasma AGT, and adipose tissue AGT gene expression in mice with a wild-type genetic background.17,18 The relationship between blood pressure and the RAAS in obese humans comes mostly from observational and not from intervention studies. The influence of weight loss on RAAS activity, especially on AGT plasma levels and the adipose tissue RAAS, has not been explored.

Methods

The institutional review board approved both studies; all volunteers gave informed written consent. Thirty-eight white menopausal women participated in the cross-sectional study, 30 menopausal women started the weight reduction protocol, and 17 achieved the 5% body weight reduction goal. None had diabetes mellitus, liver disease, congestive heart failure, coronary heart disease, or microalbuminuria. Hormonal replacement therapy was stopped 4 weeks and all other medication 7 days before the studies. No concomitant medication was allowed during weight loss. We took the precaution that no subject lost >1 kg in weight during the 3 months before both protocols. Anthropometric measurements and fasting blood samples were obtained at 9:00 A.M. Abdominal subcutaneous adipose tissue samples were taken by needle biopsy from the periumbilical region.13 Appropriate cuff size was used for 24-hour ambulatory blood pressure measurement (SPACELABS 90207). Homeostasis model assessment (HOMA) index of insulin resistance was calculated.13 In the weight loss study, dietary consultation to reduce energy intake by 600 kcal/d and water gymnastics exercises were begun the day after clinical assessments. Adipose tissue biopsies and clinical measurements were repeated after a 5% body weight loss was achieved. Four-day nutrition diaries were kept. Urine was collected for 24 hours at the beginning and at the end of the weight loss study in parallel to ambulatory blood pressure measurement.

We isolated and processed mRNA for real-time polymerase chain reaction (TaqMan technology by PE Biosystems, Weiterstadt, Germany) as described in detail previously.13 The standard curve method was used for the target genes (AGT, renin, renin-receptor, ACE, angiotensin II type-1 [AT1] receptor) and the internal control gene (human glyceraldehyde-3-phosphate dehydrogenase, GAPDH) in identical RNA samples. Expression of the target genes was normalized by GAPDH expression in each sample and is given in arbitrary units. Expression of the renin receptor gene in isolated human adipocytes was detected by our group (data not shown) and has not been reported before. The sequences used for real-time polymerase chain reaction were: forward primer, 5'CCAGGACTCGCAGTGGGTAA3'; reverse primer, 5'CACTCCCTTCACCATCACCAT3'; fluorescently labeled probe, 6-FAM-5'TGTTTCATCGTCCTCGGGCTACCG3'-TAMRA. Interassay coefficients of variation were 1.8% for GAPDH, 6.7% for AGT, 6.4% for renin, 3.1% for the renin receptor, 6.6% for ACE, and 6.8% for the AT1 receptor.

Fasting plasma and serum samples were collected after 30 minutes of rest in the supine position. Plasma AGT was determined by radioimmunoassay after the cleavage to Ang I by exogenously added human renin as described.19 Serum Ang II was measured by enzyme immunoassay after extraction with ice-cold ethanol using the Ang II EIA kit (Bachem, Germany).20 ACE activity in the serum was determined by a calorimetric assay (Sigma Diagnostics, Deisenhofen, Germany). Plasma renin and activated prorenin concentration was determined by an immunochemiluminometric assay (Nichols Institute Diagnostics, Advantage Direct Renin Assay, San Clemente, Calif). Serum aldosterone was determined by a solid-phase radioimmunoassay (DPC Biermann, Bad Nauheim, Germany). Interassay coefficients of variation were 3.4% for AGT, 17% for Ang II, 7.2% for ACE activity, 6.1% for renin, and 5.6% for aldosterone.

Data were analyzed by SPSS 11.5.1 (SPSS Inc, Chicago, Ill). All variables (mean±SD) were normally distributed. Student t test was used for group comparisons. A paired sample t test was used for baseline and weight loss data. Pearson coefficient of correlation described relationships between variables. Results were considered statistical significant at P<0.05.

Results

Table 1 shows the clinical variables from the 38 women participating in the cross-sectional study. Fasting levels of glucose, insulin, and the HOMA index of insulin resistance were increased in the obese subjects, but were not in the diabetic range. Ambulatory blood pressure and blood lipids were similar; slightly increased levels of total and low-density lipoprotein cholesterol were found in both groups. For the systemic RAAS, increased levels were found for AGT, renin, aldosterone, and ACE activity in obese subjects (Figure 1). In adipose tissue, decreased expression was found for the AGT gene in obese subjects, whereas expression of the other genes was not different between lean and obese women (Figure 2).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical Variables From the Cross-Sectional Study (mean±SD)



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Comparison of the circulating renin-angiotensin-aldosterone system between 19 lean and 19 obese postmenopausal women. Data are given as mean±SD. Group comparison by Student t test for independent samples. *P<0.05.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Comparison of adipose tissue expression of renin-angiotensin system genes between 19 lean and 19 obese postmenopausal women. Data are given as mean±SD. Group comparison by Student t test for independent samples. *P<0.05. AT1R indicates angiotensin II type-1 receptor; REN, renin; RENR, renin receptor.

Weight loss of 5% within 16 weeks was achieved by 17 of 30 women. These women were aged 59±7 years and lost 5.6±1.0% body weight during 13±2 weeks. Table 2 summarizes the changes in clinical variables, diet composition, and electrolyte excretion with weight reduction. These data demonstrate that the obese women in the cross-sectional and the weight loss studies were similar, allowing a systematic study of the RAAS in obesity and weight loss. Besides anthropometric variables, changes in systolic daily mean ambulatory blood pressure measurement, fasting insulin, and in the HOMA index were observed. Weight loss was achieved by a reduction in total food consumption; no major changes in food composition were seen. Sodium and potassium intake and excretion were not significantly decreased at the end of the study.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Changes With Weight Reduction (mean±SD)

Reduced levels were found for circulating AGT, renin, aldosterone, and ACE after weight loss (Figure 3). In adipose tissue, decreased expression was found for AGT (Figure 4). The differences between baseline and weight loss mean values was not reflected by relationships between the degree of weight loss and the degree of reduction in AGT expression, circulating AGT, renin, aldosterone, or ACE (Pearson coefficient of correlation, data not shown). However, weight loss is nonspecific, whereas a decrease in waist circumference is a valuable surrogate for the loss of visceral adipose tissue. We found a highly significant correlation between the decline in AGT plasma levels and waist circumference that was independent of the reduction in body weight or body mass index (BMI) (r=0.71; P=0.004; after correction for weight loss and reduction of BMI; Figure 5). Furthermore, the decrease of circulating AGT was strongly correlated with the decrease of AGT gene expression in adipose tissue (Figure 5). The reduction in systolic blood pressure was correlated with both plasma AGT (r=0.61; P=0.006) and AGT gene expression in adipose tissue (r=0.51; P<0.05).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. The circulating renin-angiotensin-aldosterone system before and after 5% weight loss in 17 obese postmenopausal women. Data are given as mean±SD. Group comparison by t test for paired samples. *P<0.05.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Adipose tissue expression of renin-angiotensin system genes before and after 5% weight loss in 17 obese postmenopausal women. Data are given as mean±SD. Group comparison by t test for paired samples. *P<0.05.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Relationship between the reduction in waist circumference or adipose tissue AGT expression and the decline in AGT plasma levels in 17 postmenopausal women in the weight loss study; 95% confidential intervals are given for the regression analysis.

Discussion

The higher AGT, renin, aldosterone, and ACE activity levels in obese compared with lean menopausal women suggest that the RAAS was activated in our obese subjects. This activation was reduced by 5% body weight reduction which was accompanied by a 7-mm Hg decrease in systolic 24-hour ambulatory blood pressure. In adipose tissue, AGT gene expression was decreased in obese women and decreased even further with weight loss. Besides being obese, all the women were healthy, with slightly increased cholesterol levels. None had signs and symptoms of obesity-associated end-organ damage.

Increased circulating AGT plasma levels in obesity have been described before.4–7,21 We confirmed this finding and demonstrate for the first time to our knowledge that increased AGT plasma levels in obese subjects can be reduced by 5% weight loss, close to levels in lean subjects. Furthermore, the decrease in waist circumference, a surrogate for reduced body fat mass, was a better predictor of decreased AGT plasma levels than weight loss per se. This finding directly leads to the question of whether adipose AGT secretion is involved in the determination of AGT plasma levels, as has been suggested by animal studies.16,22 This question is difficult to study in humans. Microdialysis cannot be used because of the molecular size of AGT and arteriovenous differences of AGT over adipose tissue depots have never been measured. Studying AGT gene expression instead yielded conflicting results.

We found decreased AGT expression in subcutaneous adipose tissue of obese subjects, confirming our earlier results.13 Decreased or unchanged AGT expression levels in adipose tissue of obese or hypertensive subjects have also been published by others.14,15,23 Furthermore, AGT secretion from isolated subcutaneous adipocytes was not different between lean and obese donors.24 Only 1 group reported increased expression of the AGT gene in subcutaneous and visceral adipose tissue with increased BMI or increased waist circumference.11,12 In clear contrast to animal data,16–18,22,25–27 most human studies did not support increased adipose tissue AGT expression in obesity. Decreased adipose tissue AGT expression after weight loss has not been reported previously. Although AGT secretion from adipocytes is well documented, we cannot exclude the possibility that other cell types than adipocytes (eg, endothelial cells, lymphocytes, monocytes/macrophages) contribute to decreased AGT formation in adipose tissue. Furthermore, we cannot exclude the possibility that the secretion of AGT from the liver decreases with weight loss in our study. Animal data, however, strongly suggest that AGT secretion from the liver is not influenced by obesity or weight loss.22,27

If adipocytes contribute to circulating AGT levels in humans, then increased adipose tissue mass itself would be sufficient to increase AGT plasma levels in the obese. Increased AGT expression on the adipocyte level is not a necessary requirement. Decreased AGT expression in adipose cells during the weight loss period, together with decreased adipose tissue mass, could contribute to the decline of plasma AGT with weight loss. A strong relationship between the decrease in adipose tissue AGT expression and circulating AGT levels was found in our study. We thus propose a negative feedback loop that controls adipocyte AGT expression in the situation of increasing AGT plasma levels in the obese. Weight loss may add a regulatory mechanism that further reduces AGT expression in adipose tissue. Decreased AGT plasma levels may then foster the decreased blood pressure. This model is based on the assumption that adipose tissue AGT enters the systemic circulation. In mice, this state of affairs is the case.16

The mechanisms that may control AGT expression in the obese and reduce AGT expression during weight loss are not known. No convincing hormonal regulators of the AGT gene have been identified in human or animal adipocytes.3 Several studies suggested the importance of AGT genotypes for the body weight–blood pressure relationship.28–31 How these variants (AGT-6, AGT-20, AGT174, AGT235) might control AGT expression and plasma AGT levels is not known. Furthermore, negative results have also been obtained for the AGT235 genotype and obese phenotypes.5,32 AGT secretion from isolated human adipocytes was not influenced by the AGT235 genotype.24 With respect to weight loss, AGT-6 genotypes were associated with the reduction of blood pressure, but not with weight loss itself.33

Our data confirm higher renin and aldosterone levels in obese subjects.8–10,34 Increased renin and aldosterone levels are not necessarily expected, because obese subjects typically present with sodium retention and volume expansion.35 Overactivity of the renal sympathetic nervous system may stimulate renin release in the obese.36 The renal sympathetic nerve activity may be stimulated by leptin that could represent the link between increased renin levels and increased fat mass.37 An oxidized derivative of linoleic acid was a potent stimulator of aldosterone secretion in an earlier in vitro study.38 Furthermore, conditioned media of human adipocytes contained biochemical substances that increased aldosterone secretion in vitro independent of potassium or AT1 receptor activation.39 Weight loss decreased circulating renin and aldosterone levels in our study, confirming earlier findings.8,40,41 High renin levels have been shown to predict the decline in blood pressure induced by weight loss,42 but we did not see a close relationship between renin or aldosterone reduction and weight or blood pressure reduction in our study (data not shown). The mechanisms that may increase renin in the obese are reduced by weight loss.43,44 The mechanisms that decrease circulating aldosterone in weight reduced subjects are less clear, but decreased renin activity per se may contribute, as well as the possible reduction of adipocyte products and oxidized fatty acid derivatives. Sodium and potassium intake did not change during the weight loss period and are thus unlikely to be involved. Weight loss may reduce renin and aldosterone by different mechanisms, because the baseline renin and aldosterone levels were highly correlated (r=0.75; P<0.01), but not after the weight loss levels.

Higher ACE activity in obesity and the decrease in ACE activity with weight loss have been described previously.5,40 The DD genotype of the ACE gene may predict abdominal obesity and larger increases in body weight and blood pressure with aging in men.32 Furthermore, the DD genotype influenced the sensitivity of blood pressure to weight loss, but not the amount of weight loss per se.45 The decrease of ACE activity with weight loss, however, was not closely linked to the reduction in blood pressure in our study (data not shown). In obese mice, renal ACE activity was significantly increased in an endothelin receptor type A-dependent manner.46 Other tissues have not been examined in this study.

Whereas circulating levels of the RAAS were increased in obese subjects and reduced by weight loss, the adipose tissue RAAS gene expression, with the exception of the AGT gene, was not influenced by obesity or weight loss. This finding is consistent with earlier results.13–15 If the lack of RAAS gene regulation in obesity is transformed into local Ang II production in adipose tissue, we can speculate that a dysregulated Ang II formation and action is not of great importance for the disturbed adipose tissue metabolism in obesity. Findings using the microdialysis technique in adipose tissue corroborate this speculation.47 The microdialysis data, as well as the data presented here, have been obtained in subcutaneous adipose tissue. It is known that at least the expression of AGT is 2-fold higher in visceral adipose tissue compared with subcutaneous adipose tissue.3 Furthermore, several metabolic complications of obesity are more closely linked to the presence of increased visceral adipose tissue than to BMI itself.48 Thus, our findings are restricted to a specific adipose tissue depot. However, subcutaneous adipose tissue represents {approx}75% of the total body fat mass. Changes in regulation of genes encoding secreted proteins in subcutaneous adipose tissue are therefore likely to have an important impact. In clinical practice, visceral adipose tissue accumulation is determined by measuring waist circumference. The close relationship between decreased AGT plasma levels and the reduction of waist circumference in our study supports the assumption that visceral adipose tissue reacts similar to subcutaneous adipose tissue under the condition of weight loss.

Perspectives
Obesity is associated with increased levels of the circulating RAAS (AGT, renin, aldosterone, ACE). These increased levels were significantly decreased by 5% body weight loss. The downregulated AGT expression in adipose tissue in response to weight loss supports the assumption that AGT plasma levels are linked to AGT gene expression in adipose tissue. Furthermore, the reductions in AGT expression in adipose tissue and circulating AGT were correlated to the reduction in systolic blood pressure. These data suggest that reduced body fat mass may lower RAAS activity in plasma and adipose tissue, a finding with therapeutic implications.

Acknowledgments

The German Human Genome Project (BMBF 01KW0011) supported this study. We thank Iris Gottschalk, Gritt Stoffels, and Anke Strauß for their help with the volunteers, and Henning Damm and Irene Strauss for their expert technical help.

Received September 14, 2004; first decision October 3, 2004; accepted December 3, 2004.

References

1. Wilson PW, D’Agostino RB, Sullivan L, Parise H, Kannel WB. Overweight and obesity as determinants of cardiovascular risk: the Framingham experience. Arch Intern Med. 2002; 162: 1867–1872.[Abstract/Free Full Text]

2. Mikhail N, Golub MS, Tuck ML. Obesity and hypertension. Prog Cardiovasc Dis. 1999; 42: 39–58.[CrossRef][Medline] [Order article via Infotrieve]

3. Engeli S, Schling P, Gorzelniak K, Boschmann M, Janke J, Ailhaud G, Teboul M, Massiera F, Shrama AM. The adipose-tissue renin-angiotensin-aldosterone system: role in the metabolic syndrome? Int J Biochem Cell Biol. 2003; 35: 807–825.[CrossRef][Medline] [Order article via Infotrieve]

4. Bloem LJ, Manatunga AK, Tewksbury DA, Pratt JH. The serum angiotensinogen concentration and variants of the angiotensinogen gene in white and black children. J Clin Invest. 1995; 95: 948–953.[Medline] [Order article via Infotrieve]

5. Cooper R, McFarlane Anderson N, Bennett FI, Wilks R, Puras A, Tewksbury D, Ward R, Forrester T. ACE, angiotensinogen and obesity: a potential pathway leading to hypertension. J Hum Hypertens. 1997; 11: 107–111.[CrossRef][Medline] [Order article via Infotrieve]

6. Cooper R, Forrester T, Ogunbiyi O, Muffinda J. Angiotensinogen levels and obesity in four black populations. ICSHIB Investigators. J Hypertens. 1998; 16: 571–575.[CrossRef][Medline] [Order article via Infotrieve]

7. Umemura S, Nyui N, Tamura K. Hibi K, Yamaguchi S, Nakamura M, Ishigami T, Yabana M, Kihara M, Inoue S, Ishii M. Plasma angiotensinogen concentrations in obese patients. Am J Hypertens. 1997; 10: 629–633.[CrossRef][Medline] [Order article via Infotrieve]

8. Goodfriend TL, Kelley DE, Goodpaster BH, Winters SJ. Visceral obesity and insulin resistance are associated with plasma aldosterone levels in women. Obes Res. 1999; 7: 355–362.[Medline] [Order article via Infotrieve]

9. Licata G, Scaglione R, Ganguzza A, Corrao S, Donatelli M, Parrinelleo G, Dichiara MA, Merlino G, Cecala MG. Central obesity and hypertension: Relationship between fasting serum insulin, plasma renin activity, and diastolic blood pressure in young obese subjects. Am J Hypertens. 1994; 7: 314–320.[Medline] [Order article via Infotrieve]

10. Messerli FH, Christie B, DeCarvalho JG, Aristimuno GG, Suarez DH, Dreslinksi, Frohlich ED. Obesity and essential hypertension. Hemodynamics, intravascular volume, sodium excretion, and plasma renin activity. Arch Intern Med. 1981; 141: 81–85.[Abstract/Free Full Text]

11. Van Harmelen V, Elizalde M, Ariapart P, Bergstedt Lindqvist S, Reynisdottir S, Hoffstedt J, Lundkvist I, Brigman S, Arner P. The association of human adipose angiotensinogen gene expression with abdominal fat distribution in obesity. Int J Obes. 2000; 24: 673–678.[CrossRef][Medline] [Order article via Infotrieve]

12. Van Harmelen V, Ariapart P, Hoffstedt J, Lundkvist I, Bringman S, Arner P. Increased adipose angiotensinogen gene expression in human obesity. Obes Res. 2000; 8: 337–341.[Medline] [Order article via Infotrieve]

13. Gorzelniak K, Engeli S, Janke J, Luft FC, Sharma AM. Hormonal regulation of the human adipose-tissue renin-angiotensin system: relationship to obesity and hypertension. J Hypertens. 2002; 20: 965–973.[CrossRef][Medline] [Order article via Infotrieve]

14. Faloia E, Gatti C, Camilloni MA, Mariniello B, Sardu C, Garrapa GG, Mantero F, Giacchetti G. Comparison of circulating and local adipose tissue renin-angiotensin system in normotensive and hypertensive obese subjects. J Endocrinol Invest. 2002; 25: 309–314.[Medline] [Order article via Infotrieve]

15. Giacchetti G, Faloia E, Mariniello B, Sardu C, Gatti C, Camilloni MA, Guerrieri M, Mantero F. Overexpression of the renin-angiotensin system in human visceral adipose tissue in normal and overweight subjects. Am J Hypertens. 2002; 15: 381–388.[CrossRef][Medline] [Order article via Infotrieve]

16. Massiera F, Bloch-Faure M, Ceiler D, Murakami K, Fukamizu A, Gasc JM, Quignard-Boulange A, Negrel R, Ailhaud G, Seydoux J, Meneton P, Teboul M. Adipose angiotensinogen is involved in adipose tissue growth and blood pressure regulation. FASEB J. 2001; 15: 2727–2729.[Free Full Text]

17. Masuzaki H, Yamamoto H, Kenyon CJ, Elmquist JK, Morton NM, Paterson JM, Shinyama H, Sharp MG, Fleming S, Mullins JJ, Seckl JR, Flier JS. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. J Clin Invest. 2003; 112: 83–90.[CrossRef][Medline] [Order article via Infotrieve]

18. Tsai YS, Kim HJ, Takahashi N, Kim HS, Hagaman JR, Kim JK, Maeda N. Hypertension and abnormal fat distribution but not insulin resistance in mice with P465L PPAR{gamma}. J Clin Invest. 2004; 114: 240–249.[CrossRef][Medline] [Order article via Infotrieve]

19. Bohlender J, Ménard J, Wagner J, Luft FC, Ganten D. Human renin-dependent hypertension in rats transgenic for human angiotensinogen. Hypertension. 1996; 27: 535–540.[Abstract/Free Full Text]

20. Schling P, Schäfer T. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 2002; 277: 48066–48075.[Abstract/Free Full Text]

21. Schorr U, Blaschke K, Turan S, Distler A, Sharma AM. Relationship between angiotensinogen, leptin and blood pressure levels in young normotensive men. J Hypertens. 1998; 16: 1475–1480.[CrossRef][Medline] [Order article via Infotrieve]

22. Boustany CM, Bharadwaj K, Daugherty A, Brown DR, Randall DC, Cassis LA. Activation of the systemic and adipose renin-angiotensin system in rats with diet-induced obesity and hypertension. Am J Physiol Regul Integr Comp Physiol. 2004. Epub ahead of print.

23. Davis D, Liyou N, Lockwood D, Johnson A. Angiotensinogen genotype, plasma protein and mRNA concentration in isolated systolic hypertension. Clin Genet. 2002; 61: 363–368.[CrossRef][Medline] [Order article via Infotrieve]

24. Prat-Larquemin L, Oppert JM, Clement, Hainault I, Basdevant A, Guy-Grand B, Quignard-Boulange A. Adipose angiotensinogen secretion, blood pressure, and AGT M235T polymorphism in obese patients. Obes Res. 2004; 12: 556–561.[Medline] [Order article via Infotrieve]

25. Hainault I, Nebout G, Turban S, Ardouin B, Ferre P, Quignard-Boulange A. Adipose tissue-specific increase in angiotensinogen expression and secretion in the obese (fa/fa) Zucker rat. Am J Physiol. 2002; 282: E59–E66.

26. Rahmouni K, Mark AL, Haynes WG, Sigmund CD. Adipose depot-specific modulation of angiotensinogen gene expression in diet-induced obesity. Am J Physiol. 2004; 286: E891–E895.

27. Frederich RCJ, Kahn BB, Peach MJ, Flier JS. Tissue-specific nutritional regulation of angiotensinogen in adipose tissue. Hypertension. 1992; 19: 339–344.[Abstract/Free Full Text]

28. Hegele RA, Brunt JH, Connelly PW. Genetic variation on chromosome 1 associated with variation in body fat distribution in men. Circulation. 1995; 92: 1089–1093.[Abstract/Free Full Text]

29. Rankinen T, Gagnon J, Perusse L, Rice T, Leon AS, Skinner JS, Wilmore JH, Rao DC, Bouchard C. Body fat, resting and exercise blood pressure and the angiotensinogen M235T polymorphism: the heritage family study. Obes Res. 1999; 7: 423–430.[Medline] [Order article via Infotrieve]

30. Ishigami T, Tamura K, Fujita T, Kobayashi I, Hibi K, Kihara M, Toya Y, Ochiai H, Umemura S. Angiotensinogen gene polymorphism near transcription start site and blood pressure: role of a T-to-C transition at intron I. Hypertension. 1999; 34: 430–434.[Abstract/Free Full Text]

31. Tiago AD, Samani NJ, Candy GP, Brooksbank R, Libhaber EN, Sareli P, Woodiwiss AJ, Norton GR. Angiotensinogen gene promoter region variant modifies body size-ambulatory blood pressure relations in hypertension. Circulation. 2002; 106: 1483–1487.[Abstract/Free Full Text]

32. Strazzullo P, Iacone R, Iacoviello L, Russo O, Barba G, Russo P, Dórazio A, Barbato A, Cappuccio FP, Farinaro E, Siani A. Genetic variation in the renin-angiotensin system and abdominal adiposity in men: the Olivetti Prospective Heart Study. Ann Intern Med. 2003; 138: 17–23.[Abstract/Free Full Text]

33. Hunt SC, Cook NR, Oberman A, Cutler JA, Hennekens CH, Allender PS, Walker WG, Whelton PL, Williams RR. Angiotensinogen genotype, sodium reduction, weight loss, and prevention of hypertension: trials of hypertension prevention, phase II. Hypertension. 1998; 32: 393–401.[Abstract/Free Full Text]

34. Egan BM, Stepniakowski K, Goodfriend TL. Renin and aldosterone are higher and the hyperinsulinemic effect of salt restriction greater in subjects with risk factors clustering. Am J Hypertens. 1994; 7: 886–893.[Medline] [Order article via Infotrieve]

35. Hall JE. The kidney, hypertension, and obesity. Hypertension. 2003; 41: 625–633.[Abstract/Free Full Text]

36. Vaz M, Jennings G, Turner A, Cox H, Lambert G, Esler M. Regional sympathetic nervous activity and oxygen consumption in obese normotensive human subjects. Circulation. 1997; 96: 3423–3429.[Abstract/Free Full Text]

37. Haynes WG, Morgan DA, Walsh SA, Mark AL, Sivitz WI. Receptor-mediated regional sympathetic nerve activation by leptin. J Clin Invest. 1997; 100: 270–278.[Medline] [Order article via Infotrieve]

38. Goodfriend TL, Ball DL, Egan BM, Campbell WB, Nithipatikom K. Epoxy-keto derivative of linoleic acid stimulates aldosterone secretion. Hypertension. 2004; 43: 358–363.[Abstract/Free Full Text]

39. Ehrhart-Bornstein M, Lamounier-Zepter V, Schraven A, Langenbach J, Willenberg HS, Barthel A, Hauner H, McCann SM, Scherbaum WA, Bornstein SR. Human adipocytes secrete mineralocorticoid-releasing factors. Proc Natl Acad Sci U S A. 2003; 100: 14211–14216.[Abstract/Free Full Text]

40. Harp JB, Henry SA, DiGirolamo M. Dietary weight loss decreases serum angiotensin-converting enzyme activity in obese adults. Obes Res. 2002; 10: 985–990.[Medline] [Order article via Infotrieve]

41. Tuck ML, Sowers J, Dornfeld L, Kledzik G, Maxwell M. The effect of weight reduction on blood pressure, plasma renin activity, and plasma aldosterone levels in obese patients. N Engl J Med. 1981; 304: 930–933.[Abstract]

42. Blaufox MD, Lee HB, Davis B, Oberman A, Wassertheil Smoller S, Langford H. Renin predicts diastolic blood pressure response to nonpharmacologic and pharmacologic therapy. JAMA. 1992; 267: 1221–1225.[Abstract/Free Full Text]

43. Masuo K, Mikami H, Ogihara T, Tuck ML. Weight reduction and pharmacologic treatment in obese hypertensives. Am J Hypertens. 2001; 14: 530–538.[CrossRef][Medline] [Order article via Infotrieve]

44. Grassi G, Seravalle G, Colombo M, Bolla G, Cattaneo BM, Cavagnini F, Mancia G. Body weight reduction, sympathetic nerve traffic, and arterial baroreflex in obese normotensive humans. Circulation. 1998; 97: 2037–2042.[Abstract/Free Full Text]

45. Kostis JB, Wilson AC, Hooper WC, Harrison KW, Philipp CS, Appel LJ, Espeland MA, Folmar S, Johnson KC. Association of ACE DD genotype with blood pressure sensitivity to weight loss. Am Heart J. 2002; 144: 625–629.[Medline] [Order article via Infotrieve]

46. Barton M, Carmona R, Morawietz H, d'Uscio LV, Goettsch W, Hillen H, Haudenschild CC, Krieger JE, Munter K, Lattmann T Lüscher TF, Shaw S. Obesity is associated with tissue-specific activation of renal angiotensin-converting enzyme in vivo: evidence for a regulatory role of endothelin. Hypertension. 2000; 35: 329–336.[Abstract/Free Full Text]

47. Boschmann M, Jordan J, Adams, Christensen NJ, Tank J, Franke G, Stoffels M, Sharma AM, Luft FC, Klaus S. Tissue-specific response to interstitial angiotensin II in humans. Hypertension. 2003; 41: 37–41.[Abstract/Free Full Text]

48. Kissebah AH, Krakower GR. Regional adiposity and morbidity. Physiol Rev. 1994; 74: 761–811.[Free Full Text]




This article has been cited by other articles:


Home page
EndocrinologyHome page
T. Wada, S. Ohshima, E. Fujisawa, D. Koya, H. Tsuneki, and T. Sasaoka
Aldosterone Inhibits Insulin-Induced Glucose Uptake by Degradation of Insulin Receptor Substrate (IRS) 1 and IRS2 via a Reactive Oxygen Species-Mediated Pathway in 3T3-L1 Adipocytes
Endocrinology, April 1, 2009; 150(4): 1662 - 1669.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. Mathieu, P. Poirier, P. Pibarot, I. Lemieux, and J.-P. Despres
Visceral Obesity: The Link Among Inflammation, Hypertension, and Cardiovascular Disease
Hypertension, April 1, 2009; 53(4): 577 - 584.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. D. Fowler, S. B. Krueth, D. A. Bernlohr, and S. A. Katz
Renin dynamics in adipose tissue: adipose tissue control of local renin concentrations
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E343 - E350.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
W. Lieb, M. J. Pencina, K. J. Lanier, G. H. Tofler, D. Levy, C. S. Fox, T. J. Wang, R. B. D'Agostino Sr., and R. S. Vasan
Association of Parental Obesity With Concentrations of Select Systemic Biomarkers in Nonobese Offspring: The Framingham Heart Study
Diabetes, January 1, 2009; 58(1): 134 - 137.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
G. R. Hajer, T. W. van Haeften, and F. L.J. Visseren
Adipose tissue dysfunction in obesity, diabetes, and vascular diseases
Eur. Heart J., December 2, 2008; 29(24): 2959 - 2971.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
A. Chagnac, M. Herman, B. Zingerman, A. Erman, B. Rozen-Zvi, J. Hirsh, and U. Gafter
Obesity-induced glomerular hyperfiltration: its involvement in the pathogenesis of tubular sodium reabsorption
Nephrol. Dial. Transplant., December 1, 2008; 23(12): 3946 - 3952.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Caglayan, B. Stauber, A. R. Collins, C. J. Lyon, F. Yin, J. Liu, S. Rosenkranz, E. Erdmann, L. E. Peterson, R. S. Ross, et al.
Differential Roles of Cardiomyocyte and Macrophage Peroxisome Proliferator-Activated Receptor {gamma} in Cardiac Fibrosis
Diabetes, September 1, 2008; 57(9): 2470 - 2479.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Gupte, C. M. Boustany-Kari, K. Bharadwaj, S. Police, S. Thatcher, M. C. Gong, V. L. English, and L. A. Cassis
ACE2 is expressed in mouse adipocytes and regulated by a high-fat diet
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R781 - R788.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. A. Calhoun, D. Jones, S. Textor, D. C. Goff, T. P. Murphy, R. D. Toto, A. White, W. C. Cushman, W. White, D. Sica, et al.
Resistant Hypertension: Diagnosis, Evaluation, and Treatment: A Scientific Statement From the American Heart Association Professional Education Committee of the Council for High Blood Pressure Research
Circulation, June 24, 2008; 117(25): e510 - e526.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. A. Calhoun, D. Jones, S. Textor, D. C. Goff, T. P. Murphy, R. D. Toto, A. White, W. C. Cushman, W. White, D. Sica, et al.
Resistant Hypertension: Diagnosis, Evaluation, and Treatment: A Scientific Statement From the American Heart Association Professional Education Committee of the Council for High Blood Pressure Research
Hypertension, June 1, 2008; 51(6): 1403 - 1419.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. W. Krug and M. Ehrhart-Bornstein
Aldosterone and Metabolic Syndrome: Is Increased Aldosterone in Metabolic Syndrome Patients an Additional Risk Factor?
Hypertension, May 1, 2008; 51(5): 1252 - 1258.
[Full Text] [PDF]


Home page
J EndocrinolHome page
B Galvez-Prieto, J Bolbrinker, P Stucchi, A I de las Heras, B Merino, S Arribas, M Ruiz-Gayo, M Huber, M Wehland, R Kreutz, et al.
Comparative expression analysis of the renin-angiotensin system components between white and brown perivascular adipose tissue
J. Endocrinol., April 1, 2008; 197(1): 55 - 64.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
T. Fujita
Insulin resistance and salt-sensitive hypertension in metabolic syndrome
Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3102 - 3107.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Bentley-Lewis, G. K. Adler, T. Perlstein, E. W. Seely, P. N. Hopkins, G. H. Williams, and R. Garg
Body Mass Index Predicts Aldosterone Production in Normotensive Adults on a High-Salt Diet
J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4472 - 4475.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Muller, N. Schweitzer, O. Johren, P. Dominiak, and W. Raasch
Angiotensin II stimulates the reactivity of the pituitary-adrenal axis in leptin-resistant Zucker rats, thereby influencing the glucose utilization
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E802 - E810.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
J. M. Jones, T. C. Dowling, J.-J. Park, D. A. Phares, J.-Y. Park, T. O. Obisesan, and M. D. Brown
Human, Environmental & Exercise: Differential aerobic exercise-induced changes in plasma aldosterone between African Americans and Caucasians
Exp Physiol, September 1, 2007; 92(5): 871 - 879.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
E. Ingelsson, M. J. Pencina, G. H. Tofler, E. J. Benjamin, K. J. Lanier, P. F. Jacques, C. S. Fox, J. B. Meigs, D. Levy, M. G. Larson, et al.
Multimarker Approach to Evaluate the Incidence of the Metabolic Syndrome and Longitudinal Changes in Metabolic Risk Factors: The Framingham Offspring Study
Circulation, August 28, 2007; 116(9): 984 - 992.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Hahn, M. Backhaus, M. Broecker-Preuss, S. Tan, T. Dietz, R. Kimmig, M. Schmidt, K. Mann, and O. E Janssen
Retinol-binding protein 4 levels are elevated in polycystic ovary syndrome women with obesity and impaired glucose metabolism
Eur. J. Endocrinol., August 1, 2007; 157(2): 201 - 207.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
A. M. Jonk, A. J. H. M. Houben, R. T. de Jongh, E. H. Serne, N. C. Schaper, and C. D. A. Stehouwer
Microvascular Dysfunction in Obesity: A Potential Mechanism in the Pathogenesis of Obesity-Associated Insulin Resistance and Hypertension
Physiology, August 1, 2007; 22(4): 252 - 260.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
I. M. Wahba and R. H. Mak
Obesity and Obesity-Initiated Metabolic Syndrome: Mechanistic Links to Chronic Kidney Disease
Clin. J. Am. Soc. Nephrol., May 1, 2007; 2(3): 550 - 562.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Lu, C. M. Boustany-Kari, A. Daugherty, and L. A. Cassis
Angiotensin II increases adipose angiotensinogen expression
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1280 - E1287.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Jordan, S. Engeli, S. W. Boye, S. Le Breton, and D. L. Keefe
Direct Renin Inhibition With Aliskiren in Obese Patients With Arterial Hypertension
Hypertension, May 1, 2007; 49(5): 1047 - 1055.
[Abstract] [Full Text] [PDF]


Home page
CMAJHome page
L. Mascitelli and F. Pezzetta
Treatment of chronic respiratory diseases in obese people
Can. Med. Assoc. J., April 10, 2007; 176(8): 1130 - 1130.
[Full Text] [PDF]


Home page
HypertensionHome page
S. Kidambi, J. M. Kotchen, C. E. Grim, H. Raff, J. Mao, R. J. Singh, and T. A. Kotchen
Association of Adrenal Steroids With Hypertension and the Metabolic Syndrome in Blacks
Hypertension, March 1, 2007; 49(3): 704 - 711.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. H. Goossens, J. W.E. Jocken, E. E. Blaak, P. M. Schiffers, W. H.M. Saris, and M. A. van Baak
Endocrine Role of the Renin-Angiotensin System in Human Adipose Tissue and Muscle: Effect of {beta}-Adrenergic Stimulation
Hypertension, March 1, 2007; 49(3): 542 - 547.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
V. Achard, S. Boullu-Ciocca, R. Desbriere, G. Nguyen, and M. Grino
Renin receptor expression in human adipose tissue
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R274 - R282.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
A. Remuzzi and G. Remuzzi
Review: Potential protective effects of telmisartan on renal function deterioration
Journal of Renin-Angiotensin-Aldosterone System, December 1, 2006; 7(4): 185 - 191.
[Abstract] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Nagase, S. Yoshida, S. Shibata, T. Nagase, T. Gotoda, K. Ando, and T. Fujita
Enhanced Aldosterone Signaling in the Early Nephropathy of Rats with Metabolic Syndrome: Possible Contribution of Fat-Derived Factors
J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3438 - 3446.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Engeli, M. Boschmann, P. Frings, L. Beck, J. Janke, J. Titze, F. C. Luft, M. Heer, and J. Jordan
Influence of Salt Intake on Renin-Angiotensin and Natriuretic Peptide System Genes in Human Adipose Tissue
Hypertension, December 1, 2006; 48(6): 1103 - 1108.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. Janke, S. Engeli, M. Boschmann, F. Adams, J. Bohnke, F. C. Luft, A. M. Sharma, and J. Jordan
Retinol-binding protein 4 in human obesity.
Diabetes, October 1, 2006; 55(10): 2805 - 2810.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
T. Fujita
The Renin System, Salt-Sensitivity and Metabolic Syndrome
Journal of Renin-Angiotensin-Aldosterone System, September 1, 2006; 7(3): 181 - 183.
[PDF]


Home page
CJASNHome page
D. A. Calhoun
Aldosteronism and Hypertension
Clin. J. Am. Soc. Nephrol., September 1, 2006; 1(5): 1039 - 1045.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Bochud, J. Nussberger, P. Bovet, M. R. Maillard, R. C. Elston, F. Paccaud, C. Shamlaye, and M. Burnier
Plasma Aldosterone Is Independently Associated With the Metabolic Syndrome
Hypertension, August 1, 2006; 48(2): 239 - 245.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
E. G. Krause, K. S. Curtis, T. L. Stincic, J. P. Markle, and R. J. Contreras
Oestrogen and weight loss decrease isoproterenol-induced Fos immunoreactivity and angiotensin type 1 mRNA in the subfornical organ of female rats
J. Physiol., May 15, 2006; 573(1): 251 - 262.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. M. Sharma
Telmisartan: The ACE of ARBs?
Hypertension, May 1, 2006; 47(5): 822 - 823.
[Full Text] [PDF]


Home page
Circ. Res.Home page
I. Fleming
Signaling by the Angiotensin-Converting Enzyme
Circ. Res., April 14, 2006; 98(7): 887 - 896.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
K. Narkiewicz
Obesity and hypertension--the issue is more complex than we thought
Nephrol. Dial. Transplant., February 1, 2006; 21(2): 264 - 267.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Boschmann, S. Engeli, F. Adams, G. Franke, F. C. Luft, A. M. Sharma, and J. Jordan
Influences of AT1 receptor blockade on tissue metabolism in obese men
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R219 - R223.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Engeli, J. Bohnke, M. Feldpausch, K. Gorzelniak, J. Janke, S. Batkai, P. Pacher, J. Harvey-White, F. C. Luft, A. M. Sharma, et al.
Activation of the Peripheral Endocannabinoid System in Human Obesity
Diabetes, October 1, 2005; 54(10): 2838 - 2843.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
45/3/356    most recent
01.HYP.0000154361.47683.d3v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Engeli, S.
Right arrow Articles by Sharma, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Engeli, S.
Right arrow Articles by Sharma, A. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity
*Weight Control
Related Collections
Right arrow Obesity
Right arrow ACE/Angiotension receptors
Right arrow Gene expression
Right arrow Other Treatment