Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2005;46:144-150
Published online before print June 6, 2005, doi: 10.1161/01.HYP.0000170464.41776.98
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/1/144    most recent
01.HYP.0000170464.41776.98v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuo, K.
Right arrow Articles by Tuck, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuo, K.
Right arrow Articles by Tuck, M. L.
Related Collections
Right arrow Clinical Studies

(Hypertension. 2005;46:144.)
© 2005 American Heart Association, Inc.


Original Articles

Lys418Asn Polymorphism of the {alpha}2-Adrenoceptor Gene Relates to Serum Uric Acid Levels But Not to Insulin Sensitivity

Kazuko Masuo; Tomohiro Katsuya; Yuxiao Fu; Hiromi Rakugi; Toshio Ogihara; Michael L. Tuck

From the Human Neurotransmitter Laboratory (K.M.), Baker Heart Research Institute, Melbourne, Victoria, Australia; Department of Geriatric Medicine (K.M., T.K., Y.F., H.R., T.O.), Osaka University Graduate School of Medicine, Suita, Japan; and Endocrinology and Metabolism Division (M.L.T.), Sepulveda VA Medical Center and the David Geffen UCLA School of Medicine, Los Angeles, Calif.

Correspondence to Kazuko Masuo, MD, PhD, Baker Heart Research Institute, PO Box 6492 St Kilda Rd Central, Melbourne, Victoria 8008, Australia. E-mail kmasuo{at}baker.edu.au


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Hyperuricemia is associated with cardiovascular risk. The present study examines the association between serum uric acid (UA) elevation and the {alpha}2-, ß2-, and ß3-adrenoceptor polymorphisms. In 219 nonobese, normotensive, normouricemic (serum UA <6.5 mg/dL at entry) men, serum UA, plasma norepinephrine (NE), the homeostasis model assessment of insulin resistance (HOMA-IR), body mass index, total body fat mass, the {alpha}2A(Lys418Asn)-, ß2(Arg16Gly, Gln27Glu)-, and ß3(Trp64Arg)-adrenoceptor polymorphisms were measured annually over 5 years. Hyperuricemia was defined as a serum UA level of ≥mean+1 SD of 5.0 mg/dL in the participants. At entry, there were 36 subjects who had hyperuricemia and 183 who had normal UA levels. A significant UA elevation for 5 years was defined as an increase in ≥10% in UA levels. There were 82 subjects who had significant UA elevations. The subjects who had hyperuricemia at entry in addition to the subjects who had significant UA elevations over the 5-year period carried a significantly higher frequency of the Asn418 allele of Lys418Asn. Additionally, subjects carrying the Asn418 allele had higher UA and plasma NE and greater elevations in UA over the study period, but HOMA-IR was similar. Insulin resistance at entry and during the study was associated with Arg16Gly polymorphisms but not with Lys418Asn polymorphisms. In conclusion, the Asn418 allele of Lys418Asn is associated with either established hyperuricemia or the progressive elevation of UA over time. This polymorphism was not associated with insulin resistance in nonobese, normotensive individuals. Although hyperuricemia is of known relevance to insulin resistance, it appears to have different genetic determinants from insulin resistance in terms of adrenoceptor polymorphisms.


Key Words: uric acid • polymorphism • insulin resistance


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Many large epidemiological studies have identified a strong association between increased serum uric acid (UA) and cardiovascular risk such as increased hypertension or coronary heart disease in the general population.1–7 We also reported that serum UA level predicts future blood pressure (BP) elevation and weight gain in a longitudinal study.8 The metabolic syndrome and insulin resistance are clustered by the additional associations of hyperuricemia, obesity, hypertriglyceridemia, glucose intolerance, and hypertension. Thus, hyperuricemia is thought of as an inherent component of the metabolic syndrome. UA also has been proposed as a marker of insulin resistance;9–11 however, others claim that a serum UA is more a risk factor for cardiovascular disease rather than insulin resistance.12 Insulin resistance is recognized to have some genetic components of which polymorphisms of the ß2- and ß3-adrenoceptor system play an important role.13–17 Similar to UA, total body fat mass or stored fat in the abdominal area (abdominal obesity) is closely related to insulin resistance and {alpha}2A-adrenoceptor polymorphism.18

The present study examined the relationship between alterations in serum UA and certain polymorphism of the {alpha}- and ß-adrenoceptor system, which is reported as the associations with insulin resistance. We examined the polymorphisms of {alpha}2A (Lys418Asn)-, ß2 (Arg16Gly, Gln27Glu)-, and ß3 (Trp64Arg)-adrenoceptor genes in entry hyperuricemic, nonobese, normotensive subjects and in those normouricemic men studied over a 5-year longitudinal period.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Subjects
Subjects were recruited from 1121 men who were working in a company in Osaka, Japan, as part of their annual medical evaluation. Subjects at study entry were excluded who were >50 years of age, had obesity (body mass index [BMI] ≥25 kg/m2), diabetes mellitus (fasting glucose level >100 mg/dL), hypertension (≥140/90 mm Hg), or renal dysfunction (proteinuria, microscopic hematuria, blood urea nitrogen [BUN] ≥20.0 mg/dL or creatinine ≥1.3 mg/dL). Additional exclusions were subjects who were taking medications for hypertension, hyperlipidemia, hyperuricemia, or other illness. The goal of the present study was to clarify the relationships among the genetic variance in {alpha}2A-, ß2-, and ß3-adrenoceptor activity and the UA system. Thus, to minimize the influence of changes in body weight or BP levels on serum UA levels and insulin sensitivity, only subjects who had been free from significant changes (<10%) in body weight and BP levels over a 5-year period were enrolled in this study.8,10,19 After exclusion, 219 young, nonobese (BMI <25 kg/m2), normotensive (<140/90 mm Hg), normal renal function (no proteinuria, no microscopic hematuria, BUN <20.0 mg/dL, and creatinine <1.3 mg/dL) men on no medications were analyzed in the present study. Informed consent was obtained from each subject, as approved by the ethics committee of Osaka University Graduate School of Medicine, Japan.

Measurements
After an overnight fast of >12 hours, BMI, total body fat mass, ratio of waist circumference to hip circumference (waist-to-hip ratio), BP, heart rate, and venous sampling for serum UA, BUN, creatinine, plasma norepinephrine (NE), insulin, leptin, glucose, and the extraction of genomic DNA from leukocytes were sampled after a 30-minute rest period in the supine position in a quiet room. Measurements were made at entry and every year for 5 years. BP and heart rate were measured at each review >3 times in the supine position by an automated sphygmomanometer (TM-2713; A&D) using an adjusting cuff size based on arm circumference, which has been standardized against a mercury sphygmomanometer, and were averaged. Those who had a wide variability in BP and heart rate were asked to return for repeated measurements on >3 separate visits to exclude chance variation. The percentage body fat mass was determined with impedance measurements (BF-102; Tanita), and total body fat mass (in kilograms) was calculated according to the formula: [percentage body fat mass (%)/100] xbody weight (kg). Homeostasis model assessment of insulin resistance (HOMA-IR) was defined as the product of fasting plasma insulin (µU/mL) and glucose (mg/dL) divided by 405.20,21

Laboratory Determinations
Plasma NE was measured by high-performance liquid chromatography (HPLC) with a fluorometric method as described previously in detail,8 and plasma immunoreactive insulin was measured by a standard radioimmunoassay method as described in detail (insulin RIABEAD II; Dinabott).8 Plasma leptin was measured by radioimmunoassay as described (human leptin RIA kit; Linco).8 Serum UA, BUN, creatinine, and glucose were measured by Autoanalyzer (Hitachi-7050).

Genotyping
Genotyping was performed by the TaqMan assay as described previously.13–17,22–24 One polymorphism in the {alpha}2A-adrenergic receptor (lysine/asparagine substitution, Lys418Asn),22 2 polymorphisms in the ß2-adrenergic receptors (arginine/glycine substitution, Arg16Gly; glutamine/glutamate substitution, Gln27Glu) of the ß2-adrenoceptor genes,14 and 1 polymorphism (tryptophan/arginine substitution, Trp64Arg) of the ß3-adrenoceptor gene15,16 were evaluated. The probes and primers used in the TaqMan assay were as follows. For the Lys418Asn single-nucleotide polymorphisms (SNPs) in the {alpha}2A-adrenergic receptor gene, the probes and primers were as follows: GTAGACTCACGCTGACTGCAG and GAAACTGTACAGTTTGGCAGGC. For SNPs in the ß2-adrenergic receptor gene and the Trp64Arg SNP in the ß3-adrenergic receptors, the probes and the primers were reported previously.24

Statistical Analysis
Values are shown as mean±SD. Changes in measured parameters within each group and differences among groups were examined by 2-way ANOVA. When these differences were significant, the Dunnett test was used to determine whether the differences of the mean measured variables at year 5 were significant within the groups and among the groups from baseline. The Mantel–Haenszel {chi}2 test was used to compare differences in the genotype frequencies between relatively hyperuricemic subjects and relatively normouricemic subjects and between the subjects with and without a significant UA elevation over 5 years. Also compared were relatively insulin-sensitive subjects versus relatively insulin-resistant subjects and subjects with versus without a significant increase in HOMA-IR. Multiple linear regression analyses were used to examine relationships among variables using changes in serum UA for 5 years as a dependent variable to evaluate the relationships with plasma NE, insulin sensitivity, body weight, and BP levels. Hardy–Weinberg equilibrium was estimated with the {chi}2 test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Prevalence of Entry Hyperuricemia, UA Elevation Over Time, Entry Insulin Resistance, and Increase in HOMA-IR
Entry hyperuricemia and insulin resistance were defined as serum UA levels of ≥mean+1 SD of 5.0 mg/dL (4.5+0.5 mg/dL) at entry and HOMA-IR of ≥mean+1 SD of 2.0 (1.5+0.5) in all participants. At entry, there were 36 subjects who had a hyperuricemia and 183 subjects who were normouricemic (Table 1). There were 47 subjects who were insulin resistant and 172 subjects who were insulin sensitive. To repeat, a significant serum UA elevation and an increase in HOMA-IR were defined as ≥10% elevation over 5 years in serum UA levels or HOMA-IR compared with the values at entry. There were 82 men who had a significant UA elevation (≥10%) over the 5-year period and 137 men who did not have a UA elevation (<10%). There were 32 subjects who had a significant increase in HOMA-IR and 187 subjects who did not have an increase in HOMA-IR. There were 13 subjects who had entry hyperuricemia and insulin resistance and 149 subjects who were normouricemic and insulin sensitive.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Comparisons of Characteristics in Entry Hyperuricemic Subjects (serum UA ≥5.0 mg/dL) and Entry Normouricemic Subjects (serum UA <5.0 mg/dL)

Characteristics in the Entry Hyperuricemic Subjects and in Those Who Had a Significant UA Elevation Over the 5 Years
Subjects with hyperuricemia at entry also had higher levels of plasma NE, total body fat mass and waist-to-hip ratio compared with entry normouricemic subjects, but insulin sensitivity (HOMA-IR) was similar in both groups (Table 1). At year 5, BMI, total body fat mass, waist-to-hip ratio, and mean BP were greater in subjects who had entry hyperuricemia. Because the increases in those variables over 5 years were greater in the entry hyperuricemic subjects, this finding suggests that serum UA levels could predict future BP elevation and weight gain.8 The subjects who had UA elevation also had higher plasma NE levels and waist-to-hip ratios at entry and year 5, whereas serum UA, BMI, total body fat mass, BP levels, and HOMA-IR at entry were similar between subjects with and without UA elevation. These findings suggest that plasma NE and abdominal obesity, but not body weight or BP levels, are better predictors of future serum UA elevation (Table 2). Twenty-nine subjects who were hyperuricemic at entry had further UA elevation over the 5-year period.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Comparisons of Characteristics in Subjects Between With (≥10%) and Without (<10%) a Significant Serum UA Elevation

Frequencies of Genotypes and Alleles of the {alpha}2- and ß2-Adrenoceptor Polymorphisms
Subjects who had entry hyperuricemia as well as a UA elevation over time had a higher frequency of the Asn418 allele and the Asn418/Asn418 genotype. Subjects who had entry insulin resistance or a significant increase in HOMA-IR over a 5-year period had higher frequency of the Gly16 allele of the Arg16Gly but similar frequency of the Asn418 allele of the Lys418Asn (Table 3). The allele frequencies of Gln27Glu and Trp64Arg were similar between the entry hyperuricemic subjects and normouricemic subjects and between the entry insulin-resistant group and insulin-sensitive group.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Frequencies of {alpha}2- and ß2-Adrenoceptor Polymorphisms in Entry Hyperuricemic Subjects (serum UA ≥5.0 mg/dL), in Subjects Who Had a Significant UA Elevation (≥10%), in Entry Insulin-Resistant Subjects (HOMA ≥2.0), and in Subjects With an HOMA-IR Increase (≥10%)

Subjects who had hyperuricemia and insulin resistance at entry period (n=13) had higher frequency of the Asn418 allele compared with subjects who had normouricemia but insulin resistance (n=34; {chi}2=13.73; P<0.001), but the frequency of the Gly16 allele was similar between the 2 groups ({chi}2=1.43; P=0.232). Subjects carrying hyperuricemia and insulin resistance also had higher frequency of the Gly16 allele compared with those who had hyperuricemia but no insulin resistance ({chi}2=9.76; P=0.002), whereas the frequencies of the Asn418 allele were similar ({chi}2=1.62; P=0.203). Further, they had higher frequency of the Asn418 and Gly16 alleles compared with the subjects who were normouricemic and insulin sensitive (n=149; {chi}2=3.66, P=0.050; {chi}2=5.03, P=0.025, respectively). The findings indicate that even in the subjects who had low BMI and normal insulin sensitivity (the majority of them were in HOMA-IR <2.5), the Asn418 allele relates to serum UA levels and the Gly16 allele links to insulin resistance.

Relationships Between the Asn418 Allele of the {alpha}2-Adrenoceptor Polymorphism and Serum UA Levels
To evaluate the contributions of Asn418 allele to UA levels, we compared the results in the subjects with versus without Asn allele of the Lys418Asn. Subjects carrying the Asn418 allele had higher levels of serum UA, plasma NE, and waist-to-hip ratio at entry and at 5 years, but BMI, total body fat mass, BP levels, plasma leptin levels, and HOMA-IR were similar. The increases in serum UA, total body fat mass and waist-to-hip ratio over the 5-year study period were significantly greater in the subjects carrying Asn418 allele compared with those without Asn418 allele (Table 4).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Comparisons of Characteristics Between Subjects Without and With Asn418 Allele (Lys418/Lys418 vs Lys418/Asn418+Asn418/Asn418 genotypes)

Relationships Between the Gly16 Allele of the ß2-Adrenoceptor Polymorphism and HOMA-IR
Subjects carrying the Gly allele had higher levels of serum UA, plasma NE, HOMA-IR, total body fat mass, and waist-to-hip ratio at entry and the 5-year period (Table 5).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Comparisons of Characteristics Between Subjects Without and With Gly16 allele (Arg16/Arg16+Arg16/Gly16 vs Gly16/Gly16 genotypes)

What Variables Predict Serum UA Elevation Over Time?
When we analyzed multiple linear regression analysis using change in serum UA for 5 years as a dependent variable, plasma NE (P=0.008), serum UA (P=0.013), and waist-to-hip ratio (P=0.047) at entry were the significant determinant variables (R2=0.577; F=6.67; P<0.001). Serum UA level at any time was determined by waist-to-hip ratio (P=0.030 at entry; P=0.025 at year 5), and plasma NE (P=0.042 and P=0.047, respectively; and R2=0.629, F=16.54, P<0.001; R2=0.487, F=11.47, P<0.001, respectively).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study shows that the Asn418 allele of the Lys418Asn of the {alpha}2A-adrenoceptor has a substantial influence on serum UA levels but not on insulin sensitivity in male subjects who were originally normouricemic, insulin sensitive, nonobese, and normotensive. Subjects carrying the Asn418 allele of the Lys418Asn have a higher serum UA level, plasma NE level, and a waist-to-hip ratio compared with those without the Asn418 allele, yet insulin sensitivity (HOMA-IR) was not different between the 2 groups. These findings demonstrate that the Asn418 allele of the {alpha}2A-adrenoceptor gene is associated with UA elevation as well as high plasma NE levels and abdominal obesity (high waist-to-hip ratio), but the polymorphism in the {alpha}2A-adrenoceptor is not associated with insulin sensitivity. Only the Gly16 allele of the Arg16Gly is linked to higher HOMA-IR (insulin resistance) and deterioration in insulin sensitivity associated with abdominal obesity and higher serum UA and plasma NE levels. Thus, hyperuricemia and insulin resistance have different genetic underpinnings in terms of any effect from polymorphism of the {alpha}2A-adrenoceptor in nonobese, normotensive subjects.

The {alpha}2-adrenoceptors play a key role in regulating neurotransmitter release in the peripheral sympathetic nervous system. Several investigators showed that the {alpha}2A-adrenoceptor–mediated inhibition of sympathetic tone and its loss leads to a hyperadrenergic state.25–27 Thus, the {alpha}2-adrenoceptor is required for inhibition of NE release. In the present study, the findings that subjects carrying the Asn418 allele (especially homozygous for the Asn418 allele) had higher plasma NE as well as UA compared with the subjects without the Asn418 allele are in accordance with the investigations that Asn418 of the Lys418Asn is associated with an impaired sympathoinhibitory effect on the {alpha}2A-presynaptic adrenoceptor gene.25–27 It has been established that hyperuricemia and elevated serum UA levels are mainly attributable to impaired renal clearance of UA and the decrease in renal blood flow to the influence of heightened sympathetic nerve activity, increased renin-angiotensin system, and hyperinsulinemia such as in obese and hypertensive individuals.4,19,28–33 Thus, it could be speculated that high plasma NE might cause the decreases in renal blood flow and resultant UA elevation. However, further studies are needed to clarify the physiological factors of the {alpha}2-adrenoceptor polymorphisms on serum UA.

Several investigations have shown the relationship of the {alpha}2-adrenoceptor polymorphisms with hypertension25 and abdominal obesity,18 whereas others have failed to show this relationship.34,35 Our subjects were originally nonobese and normotensive, with a minimizing weight change or BP change, but the subjects carrying the Asn418 allele had still greater abdominal obesity at entry and increases in abdominal obesity and BP levels over a 5-year period, accompanied by higher plasma NE. High serum UA levels accompanied by the Lys418Asn polymorphism in the present study indicate that we could not exclude the influence of increased abdominal obesity associated with heightened sympathetic nerve activity. However, it should be noted that our subjects had very low BMI, low adiposity, normal HOMA-IR at entry, and minimized weight or BP changes over 5 years; therefore, we could separate the genetic associations with UA levels from insulin resistance–mediated hyperuricemia. In the present study, serum UA level is closely associated with longitudinal BP and weight tracking, showing results similar to the investigations of shorter-term follow-up as reported previously.3,8

Insulin resistance and hyperinsulinemia play an important etiologic role in the cardiovascular risk in obesity and hypertension.11,36 The findings in the present study are Gly16 allele of the Arg16Gly ß2-adrenoceptor gene is associated with high HOMA-IR (insulin resistance) even in nonobese, normotensive subjects with normal insulin sensitivity and minimized weight change,13,14 but the presence of hyperuricemia is not linked to the higher frequency of the Gly16 allele. The subjects carrying the Gly16 allele had greater abdominal adiposity, relative insulin resistance, and higher UA and plasma NE levels compared with those without the Gly16 allele. Thus, high serum UA at entry in the subjects carrying the Gly16 allele might be associated with greater abdominal obesity and plasma NE as well as hyperinsulinemia as we reported previously.13,24 Further, both adrenoceptor polymorphisms, the Asn418 and Gly16 alleles, lead to resultant alterations in sympathostimulating effects. These observations suggest that serum UA levels might be determined directly through the Asn418 allele as well as indirectly through the Gly16 allele associated with insulin resistance, and that heightened sympathetic activity might relate to both pathways. High UA could be, in part, associated with the different polymorphism of a different adrenoceptor gene in the Asn allele of the Lys418Asn, suggesting that hyperuricemia and insulin resistance have different genetic determinants.

Perspectives
In our findings, the Asn418 allele of Lys418Asn of the {alpha}2-adrenoceptor polymorphisms is associated with either baseline hyperuricemia or progressive UA elevation over 5 years in nonobese, normotensive male individuals. The Gly16 allele of Arg16Gly is linked to baseline insulin resistance and increase in HOMA-IR. Further, entry insulin-resistant subjects had higher serum UA levels compared with those in insulin-sensitive subjects, but HOMA-IR (as an index of insulin resistance) in the entry hyperuricemic subjects was similar to those in normouricemic subjects. Not all hyperuricemic subjects were baseline insulin resistant. These findings demonstrate that the hyperuricemia and insulin resistance have different genetic determinants in terms of adrenoceptor polymorphisms, although hyperuricemia is part of the metabolic syndrome and insulin resistance. It should be noted that the subjects carrying the Asn418 and Gly16 alleles had high plasma NE at entry before UA elevation or increase in HOMA-IR, suggesting that polymorphisms of the {alpha}2A- and ß2-adrenoceptor system accompanying high plasma NE level might predict future hyperuricemia and insulin resistance.

Received February 24, 2005; first decision March 17, 2005; accepted May 5, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Culleton BF, Larson MG, Kannel WB, Levy D. Serum uric acid and risk for cardiovascular disease and death: the Framingham Heart Study. Ann Intern Med. 1999; 131: 7–13.[Abstract/Free Full Text]

2. Hoieggen A, Alderman MH, Kjeldsen SE, Julius S, Devereux RB, de Faire U, Fyhrquist F, Ibsen H, Kristianson K, Lederballe-Pedersen O, Lindholm LH, Nieminen MS, Omvik P, Oparil S, Wedel H, Chen C, Dahlof B; LIFE Study Group. The impact of serum uric acid on cardiovascular outcomes in the LIFE study. Kidney Int. 2004; 65: 1041–1049.[CrossRef][Medline] [Order article via Infotrieve]

3. Sundstrom J, Sullivan L, D’Agostino RB, Levy D, Kannel WB, Vasan RS. Relations of serum uric acid to longitudinal blood pressure tracking and hypertension incidence. Hypertension. 2005; 45: 28–33.[Abstract/Free Full Text]

4. Johnson RJ, Feig DI, Herrera-Acosta J, Kang DH. Resurrection of uric acid as a causal risk factor in essential hypertension. Hypertension. 2005; 45: 18–20.[Free Full Text]

5. Johnson RJ, Rideout BA. Uric acid and diet-insights into the epidemic of cardiovascular disease. N Engl J Med. 2004; 350: 1071–1073.[Free Full Text]

6. Alderman MH, Cohen H, Madhavan S, Kivlighn S. Serum uric acid and cardiovascular events in successfully treated hypertensive patients. Hypertension. 1999; 34: 144–150.[Abstract/Free Full Text]

7. Frohlich ED. Uric acid. A risk factor for coronary artery disease. J Am Med Assoc. 1993; 270: 378–379.[Abstract/Free Full Text]

8. Masuo K, Kawaguchi H, Mikami H, Ogihara T, Tuck ML. Serum uric acid and plasma norepinephrine concentrations predict subsequent weight gain and blood pressure elevation. Hypertension. 2003; 42: 474–480.[Abstract/Free Full Text]

9. Vuorinen-Markkola H, Yki-Jarvinen H. Hyperuricemia and insulin resistance. J Clin Endocrinol Metab. 1994; 78: 25–29.[Abstract]

10. Tsunoda S, Kamide K, Minami J, Kawano Y. Decreases in serum uric acid by amelioration of insulin resistance in overweight hypertensive patients: effect of a low-energy diet and an insulin-sensitizing agent. Am J Hypertens. 2002; 15: 698–701.

11. Tuck ML. Metabolic considerations in hypertension. Am J Hypertens. 1990; 12: 355S–365S.

12. Feig DI, Johnson RJ. Hyperuricemia in childhood primary hypertension. Hypertension. 2003; 42: 247–252.[Abstract/Free Full Text]

13. Masuo K, Katsuya T, Fu Y, Rakugi H, Ogihara T, Tuck ML. ß2-adrenoceptor polymorphism relates to insulin resistance in nonobese, normotensive individuals. Am J Hypertens. In press.

14. Large V, Hellstrom L, Reynisdottir S, Lonnqvist F, Eriksson P, Lannfelt L, Arner P. Human beta-2 adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2 adrenoceptor function. J Clin Invest. 1997; 100: 3005–3013.[Medline] [Order article via Infotrieve]

15. Clement K, Vaisse C, Manning BS, Basdevant A, Guy-Grand B, Ruiz J, Silver KD, Shuldiner AR, Froguel P, Strosberg AD. Genetic variation in the ß3-adrenergic receptor and an increased capacity to gain weight in patients with morbid obesity. N Engl J Med. 1995; 333: 352–354.[Abstract/Free Full Text]

16. Kadowaki H, Yasuda K, Iwamoto K, Otabe S, Shimokawa K, Silver K, Walston J, Yoshinaga H, Kosaka K, Yamada N, Saito Y, Hagura R, Akanuma Y, Shuldiner A, Yazaki Y, Kadowaki T. A mutation in the ß3-adrenergic receptor gene is associated with obesity and hyperinsulinemia in Japanese subjects. Biochem Biophys Res Commun. 1995; 215: 555–560.[CrossRef][Medline] [Order article via Infotrieve]

17. Walston J, Silver K, Bogardus C, Knowler WC, Celi FS, Austin S, Manning B, Strosberg AD, Stern MP, Raben N, Sorkin JD, Roth J, Shuldiner AR. Time of onset of non-insulin-dependent diabetes mellitus and genetic variation in the ß3-adrenergic-receptor gene. N Engl J Med. 1995; 333: 343–347.[Abstract/Free Full Text]

18. Garenc C, Perusse L, Chagnon YC, Rankinen T, Gagnon J, Borecki, Leon AS, Skinner JS, Wilmore JH, Rao DC, Bouchard C. The alpha2-adrenergic receptor gene and body fat content and distribution: the HERITAGE Family Study. Mol Med. 2002; 8: 88–94.[Medline] [Order article via Infotrieve]

19. Bosma RJ, van der Heide H, Oosterop EJ, de Jong PE, Navis G. Body mass index is associated with altered renal hemodynamics in non-obese healthy subjects. Kidney Int. 2004; 65: 259–265.[CrossRef][Medline] [Order article via Infotrieve]

20. Kanauchi M, Yamano S, Kanauchi K, Saito Y. Homeostasis model assessment of insulin resistance, quantitative insulin sensitivity check index, and oral glucose insulin sensitivity index in nonobese, nondiabetic subjects with high-normal blood pressure. J Clin Endocrinol Metab. 2003; 88: 3444–3446.[Abstract/Free Full Text]

21. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment. Diabetologia. 1985; 28: 412–419.[CrossRef][Medline] [Order article via Infotrieve]

22. Finley JC Jr, O’Leary M, Wester D, MacKenzie S, Shepard N, Farrow S, Lockette W. A genetic polymorphism of the {alpha}2-adrenergic receptor increases autonomic responses to stress. J Appl Physiol. 2004; 96: 2231–2239.[Abstract/Free Full Text]

23. Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Olivier M, Pesich R, Hebert J, Chen YD, Dzau VJ, Curb D, Olshen R, Risch N, Cox DR, Botstein D. High-throughput genotyping with single nucleotide polymorphisms. Genome Res. 2001; 11: 1262–1268.[Abstract/Free Full Text]

24. Masuo K, Katsuya T, Fu Y, Rakugi H, Ogihara T, Tuck ML. ß2- and ß3-adrenergic receptor polymorphisms are related to the onset of weight gain and blood pressure elevation over 5 years. Circulation. In press.

25. Hein L, Altman JD, Kobilka BK. Two functionally distinct alpha2-adrenergic receptors regulate sympathetic neurotransmission. Nature. 1999; 402: 181–184.[CrossRef][Medline] [Order article via Infotrieve]

26. Makaritsis KP, Johns C, Gavras I, Altman JD, Handy DE, Bresnahan MR, Gavras H. Sympathoinhibitory function of the {alpha}2A-adrenergic receptor subtype. Hypertension. 1999; 34: 403–407.[Abstract/Free Full Text]

27. Altman JD, Trendelenburg AU, Macmillan L, Bernstein D, Limbird L, Starke K, Kobilka BK, Hein L. Abnormal regulation of the sympathetic nervous system in {alpha}2A-adrenergic receptor knockout mice. Mol Pharmacol. 1999; 56: 154–161.[Abstract/Free Full Text]

28. Yamashita S, Matsuzawa Y, Tokunaga K, Fujioka S, Tarui S. Studies on the impaired metabolism of uric acid in obese subjects: marked reduction of renal urate excretion and its improvement by a low-caloric diet. Int J Obes. 1986; 10: 255–264.[Medline] [Order article via Infotrieve]

29. Matsuura F, Yamashita S, Nakamura T, Nishida M, Nozaki S, Funahashi T, Matsuzawa Y. Effect of visceral fat accumulation on uric acid metabolism in male obese subjects: visceral fat obesity is linked more closely to overproduction of uric acid than subcutaneous fat obesity. Metabolism. 1998; 47: 929–933.[CrossRef][Medline] [Order article via Infotrieve]

30. Ter Maaten JC, Voorburg A, Heine RJ, Ter Wee PM, Donker AJ, Gans RO. Renal handling of urate and sodium during acute physiological hyperinsulinemia in healthy subjects. Clin Sci. 1997; 92: 51–58.[Medline] [Order article via Infotrieve]

31. Cappuccio FP, Strazzullo P, Farinaro E, Trevisan M. Uric acid metabolism and tubular sodium handling. Results from a population-based study. J Am Med Assoc. 1993; 270: 354–359.[Abstract/Free Full Text]

32. Quinones Galvan A, Natali A, Baldi S, Frascerra S, Sanna G, Ciociaro D, Ferrannini E. Effect of insulin on uric acid excretion in humans. Am J Physiol. 1995; 268: E1–E5.[Medline] [Order article via Infotrieve]

33. Messerli FH, Frohlich ED, Dreslinski GR, Suarez DH, Aristimuno GG. Serum uric acid in essential hypertension: an indicator of renal vascular involvement. Arch Intern Med. 1980; 93: 817–821.

34. Umemura S, Hirawa N, Iwamoto T, Yamaguchi S, Toya Y, Kobayashi S, Takasaki I, Yasuda G, Tamura K, Ishii M, Sun L, Pettinger W. Association analysis of restriction fragment length polymorphism for alpha2-adrenergic receptor genes in essential hypertension in Japan. Hypertension. 1994; 23 (suppl I): I-203–I-206.[Medline] [Order article via Infotrieve]

35. Baldwin CT, Schwartz F, Baima J, Burzstyn M, DeStefano AL, Gavras I, Handy DE, Joost O, Martel T, Manolis A, Nicolaou M, Bresnahan M, Farrer L, Gavras H. Identification of a polymorphic glutamic acid stretch in the alpha2B-adrenergic receptor and lack of linkage with essential hypertension. Am J Hypertens. 1999; 12: 853–857.[CrossRef][Medline] [Order article via Infotrieve]

36. Ferrannini E, Buzzigoli G, Bonadonna R, Giorico MA, Oleggini M, Graziadei L, Pedrinelli R, Brandi L, Bevilacqua S. Insulin resistance in essential hypertension. N Engl J Med. 1987; 317: 350–357.[Abstract]




This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
N. Dalbeth and T. Merriman
Crystal ball gazing: new therapeutic targets for hyperuricaemia and gout
Rheumatology, March 1, 2009; 48(3): 222 - 226.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/1/144    most recent
01.HYP.0000170464.41776.98v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuo, K.
Right arrow Articles by Tuck, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuo, K.
Right arrow Articles by Tuck, M. L.
Related Collections
Right arrow Clinical Studies