| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2005;46:584.)
© 2005 American Heart Association, Inc.
Original Articles |
From the Department of Medicine, University of Virginia Health System, Charlottesville, Virginia.
Reprint requests to Helmy M. Siragy, MD, Department of Medicine, University of Virginia Health Science Center, 450 Ray C. Hunt Dr, Charlottesville, VA 22903. E-mail hms7a{at}virginia.edu
| Abstract |
|---|
|
|
|---|
Key Words: aldosterone angiotensin receptors, angiotensin II diabetes mellitus kidney
| Introduction |
|---|
|
|
|---|
45 kb, contains 9 exons and is located on chromosome 8.5 Aldosterone stimulates cellular hypertrophy, matrix formation,6,7 and cell death.8 Although aldosterone can be produced in tissues other than the adrenal gland,9 its production in the kidney has never been reported. The demonstrated benefits of aldosterone receptor blockers in diabetic nephropathy,6,1012 despite reported normal1315 or low1619 levels of plasma aldosterone, suggest that this hormone may be produced locally within the kidney. Thus, we hypothesized that there is a local renal aldosterone system. Identification of different components of an aldosterone system in the kidney would boost this hypothesis. In this study, we confirmed that CYP11B2 gene, protein, and aldosterone production are locally present in kidney and regulated by low salt intake, Ang II type 1 (AT1) receptor, and insulin-deficient diabetes hyperglycemia.
| Methods |
|---|
|
|
|---|
Adrenalectomy and Microdialysis Procedures
Bilateral adrenalectomy was performed according to previously published methods.20 A single microdialysis probe was inserted into left renal cortex as described previously.21 Each animal in the control group was instrumented by microdialysis probe but did not have adrenalectomy (sham). After adrenalectomy, rats received dexamethasone (Sigma; 250 mg/kg per day SC). On the fifth day after surgery, renal interstitial fluid (RIF) samples21 were collected from normal (n=6) and adrenalectomized (n=6) rats.
Salt Intake and Renal Aldosterone Synthase Expression
The effects of different levels of salt intake on the renal expression of aldosterone synthase were studied by placing animals for 1 week on low-salt (0.05% NaCl), normal-salt (0.5% NaCl), or high-salt (4% NaCl) diet (n=8 for each group).
Effects of Ang II and AT1 Receptor Blockade on Renal Aldosterone Synthase
Three groups of animals were implanted subcutaneously with Alzet Mini-Osmotic Pumps (Model 2001D; Durect Corporation) and filled with 0.9% NaCl (control group; n=8), Ang II (100 ng/kg per minute; n=8), or combined Ang II and valsartan (100 ng/kg per minute Ang II and 10 mg/kg per day valsartan; Novartis Pharmaceuticals; n=8).
Regulation of Renal Aldosterone Synthase Expression in Diabetic Insulin-Deficient Rat Model
Rats were divided randomly into control and diabetic groups (n=88 each group). Diabetes was induced by streptozotocin (STZ; 65 mg/kg IP). Studies were conducted for 8 weeks. Eight diabetic and 8 control animals were euthanized at the end of each week for a total study period of 8 weeks. During the fifth week of the study, 3 diabetes and 3 control groups (n=8 each) were treated with regular insulin (2 to 8 U SC twice daily to maintain blood glucose range of 60 to 100 mg/dL), valsartan (10 mg/kg per day orally), or 0.9% NaCl (0.5 mL) daily for 1 week.
At the end of each experiment, the kidneys were removed under anesthesia and stored in 80°C for quantitative real-time RT-PCR and immunohistochemistry. In some animals, the adrenal glands were also harvested for immunohistochemistry as positive control for CYP11B2.
Quantitative Real-Time RT-PCR
After kidney removal, renal cortex and medulla were separated under sterile technique. The tissue was weighed promptly and homogenized on ice, and the total renal RNA was extracted using RNeasy Kit (Qiagen). The quality of RNA was confirmed by ethidium bromide staining in 2% agarose gel. Single-stranded cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad). Gene-specific primers for aldosterone synthase were designed using the Gene Bank. The exonintron boundaries were determined using the University of California Santa Cruz Genome Bioinformatics site. The corresponding cDNA primers were selected from NM012538 and BC063166, the gene codes for rat CYP11B2 and ß-actin sequences. The specificity of the primers was verified by melting curves (iCycler; Bio-Rad) and amplified product size using agarose gel electrophoresis. Quantitative real-time RT-PCR was performed using iCycler (Bio-Rad), and threshold cycle number was determined using iCycler software version 3.0 (Bio-Rad). Reactions were performed in triplicate, and threshold cycle numbers were averaged. Nontemplate control was used as negative control. Samples were calculated with normalization to ß-actin or GAPDH. Fold downexpression or upexpression was calculated according to the formula 2(RtEt)/2(RnEn), where Rt is the threshold cycle number for the reference gene observed in the test sample, Et is the threshold cycle number for the experimental gene observed in the test sample, Rn is the threshold cycle number for the reference gene observed in the control sample, and En is the threshold cycle number for the experimental gene observed in the test sample.
Primers
Primers were: (1) aldosterone synthase (CYP11B2): forward sequence: tgagacgtggtgtgttcttgc; reverse sequence: ggcctccaagaagtcccttgc; length 126 bp (reference gene NM012538); and (2) ß-actin: forward sequence: agccatgtacgtagccatcc; reverse sequence: accctcatagatgggcacag; length 115 bp (reference gene BC063166).
Western Blot Analysis
Kidney tissue (n=8) was homogenized (crude homogenate) and then loaded (50 µg each) and separated on a 10% Criterion Tris-HCI gel (Bio-Rad), followed by blotting of the proteins onto nitrocellulose (polyvinylidene fluoride membrane; Bio-Rad). The blots were blocked with buffer (50 mmol/L Tris-HCl, pH 7.4, 0.15 mol/L NaCl, 2% BSA, and 0.1% Tween 20) for 1 hour at room temperature. Then the blots were incubated with CYP11B2 (Chemicon International, Inc.) and ß-actin (Santa Cruz Biotechnology) antibodies for 1 hour at room temperature. The blots were washed 6x with Tris-buffered saline (5 minutes) and then incubated for 1 hour at room temperature with secondary antibody conjugated with horseradish peroxidase (Bio-Rad). The blots were washed 6x with PBS (5 minutes), followed by detection of immunoreactive proteins with enhanced chemiluminescence (Amersham). The bands density was measured by Gel-Doc Imaging with Quantity One software system (Bio-Rad).
Aldosterone Synthase Immunohistochemistry
Immunohistochemistry was performed according to previously described methods.2224 Briefly, the frozen kidneys and adrenal glands were taken out from 80°C storage and placed in 18°C cryostat chamber for 1 hour. Each tissue sample was mounted with OCT (an embedding medium) on a microtome block with designed cutting orientation. The block was held firmly into cryostat microtome and 2- to 4-µm sections were cut. Sections were then picked up on histological slides and immediately dipped into Streck Tissue Fixative (NE68128; Streck Laboratories) at 4°C for 15 minutes, transferred into PBS buffer at 4°C for 30 minutes, and preabsorbed in 5% goat serum for 20 minutes before the immunostaining process. The immunostaining was performed by incubating with monoclonal CYP11B2 antibody (Chemicon International, Inc.) at 4°C overnight, followed by 1 hour of incubation with second antibody conjugated with biotin at room temperature (Sigma). Immunoreactive signal was detected with an avidin-biotin immunoperoxidase reaction (Sigma) and visualized by exposure to diaminobenzidine (Sigma). The nonspecific binding was controlled by using the mouse IgG isotype (Sigma) as a primary antibody for negative comparison. Positive immunostaining was observed under light microscopy.
Aldosterone Assay
Each sample of RIF (50 µL), plasma (50 µL), and homogenized kidney tissue (79 to 94 mg) was extracted by methylene chloride (1:2 volumes). After evaporation of methylene chloride using a vacuum centrifuge, the extract was dissolved into enzyme immunoassay buffer (1:1 volumes) and added to the assay wells (50 µL per well). Each well was added with aldosterone acetylcholinesterase inhibitor tracer (50 µL) and antiserum (50 µL) and incubated at 4°C overnight. Finally, the plate was developed by Ellmans reagent and read at a wavelength 405 nm. The concentration was calculated according to the assay manufacture standard protocol (Cayman Chemical). The assay has 100% specificity for aldosterone and 0.11% cross-reactivity with corticosterone. The aldosterone assay standard curve detection range is 3.9 to 500 pg/mL with detection limit (80% B/Bo) 5 pg/mL.
Statistical Analysis
Comparisons between normal and diabetes groups were examined by 1-way ANOVA. Comparisons between treatment groups were examined using t test. Data were expressed as mean±SE. Statistical significance was identified at P<0.05.
| Results |
|---|
|
|
|---|
3-fold higher compared with the renal medulla (Figure 1A). Low salt intake increased total renal aldosterone synthase mRNA level in normal kidney (Figure 1B). In contrast, high salt intake did not influence its expression in the kidney. Ang II increased renal aldosterone synthase mRNA, and this effect was reversed by AT1 receptor blockade with valsartan (Figure 1C). Five days after adrenalectomy, plasma aldosterone levels were undetectable (Figure 2A). However, renal cortical interstitial aldosterone levels were
75% of the levels observed in normal animals (Figure 2B). Similarly, total renal tissue aldosterone levels were detectable, although much less so than the observed levels in normal animals (Figure 2C).
|
|
Renal Aldosterone Synthase Expression in Normal and Diabetic Rats
Animals treated with STZ had a significant increase in blood glucose and failed to gain weight (Figure 3A and 3B). In diabetic animals, there was significant and progressive increase in renal aldosterone synthase mRNA (Figure 4A) compared with normal animals throughout the study. By the end of 1 week and 8 weeks after development of diabetes, there were 155% and 12-fold increase in total renal aldosterone synthase expression, respectively, compared with normal animals (Figure 4A). In diabetic animals, the increase in total renal aldosterone synthase mRNA was mainly attributable to its upregulation in the renal cortex (Figure 4B). After 6 weeks of diabetes development, there was
700% increase in renal cortical aldosterone synthase compared with nondiabetic animals (Figure 4B). Diabetes did not cause significant changes in this enzyme expression in renal medulla, and its levels were similar to those of nondiabetic animals (Figure 4B).
|
|
Regulation of Renal Aldosterone Synthase by Insulin and AT1 Receptor
After 4 weeks of diabetes development, insulin treatment for 1 week caused significant reduction in blood glucose from 319±112 mg/dL to 69±25 mg/dL and decreased renal aldosterone synthase mRNA (Figure 5A) and protein (Figure 5B) by
50% and 40%, respectively. During valsartan treatment (week 5 of diabetes), there were no significant changes in blood glucose levels (312±102 mg/dL in diabetes group versus 289±95 mg/dL in diabetes valsartan group). However, valsartan treatment caused an
75% and 70% decrease in aldosterone synthase mRNA (Figure 5A) and protein (Figure 5B), respectively.
|
Localization of Aldosterone Synthase Protein in Normal and Diabetic Kidneys
Figure 6 shows representation of immunohistochemistry staining for aldosterone synthase in the adrenal gland in normal and diabetic rat kidneys at the end of 5 weeks of diabetes. Using adrenal glands as positive control, CYP11B2 immunostaining was present in the zona glomerulosa cells (Figure 6B), although negative in the same anatomic region using mouse IgG (Figure 6A). Similarly, immunostaining for CYP11B2 with mouse IgG was negative in renal cortex (Figure 6C) and medulla (Figure 6D). In normal kidney, immunostaining for aldosterone synthase protein was detected mainly in glomeruli (Figure 6E and 6F). This staining was more visible in the nucleoli of renal glomeruli. Diabetes caused significant increase in this protein expression in renal cortex in glomeruli and proximal tubules (Figure 6G), but no increase was observed in renal medulla (Figure 6H). Treatment with insulin (Figure 6I) or valsartan (Figure 6K) reduced the immunohistochemistry staining of the aldosterone synthase in glomeruli and proximal tubules. Insulin (Figure 6J) or valsartan (Figure 6L) did not cause significant changes in aldosterone synthase protein in renal medulla.
|
| Discussion |
|---|
|
|
|---|
In this study, 5 days after adrenalectomy and complete absence of aldosterone in the plasma, we were able to detect aldosterone in the kidney. Considering the short half-life of aldosterone in the circulation (<30 minutes),29 it is highly unlikely that renal aldosterone is picked up from the circulation. Low-sodium diet and Ang II administration increased renal aldosterone synthase expression. AT1 receptor blockade reversed the Ang II upregulation of aldosterone synthase in normal kidneys. These results confirm that AT1 receptor regulates renal production of this enzyme. The influence of low salt and Ang II on renal aldosterone synthase mimics their effects on this enzyme in the adrenal gland.
We also demonstrated the upregulation of renal aldosterone synthase in a model of insulin-deficient diabetes hyperglycemia. This increase in aldosterone synthase was partially reversed by the correction of elevated blood glucose levels by insulin, suggesting that type I diabetes hyperglycemia is a stimulator of this enzyme in the kidney. However, these animals may have other intermediate mechanisms related to hyperglycemia, such as osmotic diuresis, and changes in sodium balance that could modulate the expression of this enzyme.
In diabetes, plasma aldosterone levels have been reported to be low.1619 Suppressed plasma aldosterone levels in diabetes in presence of increased aldosterone synthase expression in the kidney strongly suggest a paracrine role for aldosterone in the kidney. In this study, we report an early increase in renal aldosterone synthase gene expression in diabetes.
We have demonstrated that stimulated renal aldosterone synthase expression of insulin-deficient diabetic hyperglycemic rats can be suppressed significantly by the AT1 receptor blockade in the absence of effects on blood glucose. These results suggest that AT1 receptor is a positive regulator of aldosterone synthase in normal and diabetic kidneys. This finding adds another function for the local renal renin angiotensin system and expands on our recent findings of increased renal production of Ang II in diabetes.30 The influence of Ang II on renal aldosterone synthase is confirmed by reduction of this enzyme expression during AT1 receptor blockade, despite continued elevation of blood glucose. Normalization of blood glucose with insulin treatment reduced aldosterone synthase expression. This effect could be attributable to reduction in renal Ang II production secondary to normalization of blood glucose,30 but we cannot rule out direct insulin effects on aldosterone synthase expression.
The expression of CYP11B2 mRNA and protein and the presence of aldosterone in normal and diabetic kidney provide evidence for the presence of a local renal autocrine or paracrine aldosterone system in which aldosterone production and its receptors exist in close proximity to influence renal structure and function. In addition, we proved that this system is functional because it is regulated by sodium, AT1 receptor, hyperglycemia, and insulin. At the present time, the role of renally produced aldosterone in normal kidney is not clear or whether the observed increase in renal aldosterone synthase initiates or contributes to the progression of diabetes complications in the kidney. Future studies are needed to evaluate the role of this enzyme in health and disease.
Perspectives
By demonstrating the presence of aldosterone synthase gene, protein, and their regulation, and the presence of aldosterone in the kidney of adrenalectomized animals, we firmly established the presence of local renal aldosterone system. Understanding the role of renally produced aldosterone may help elucidate some of the pathophysiologic mechanisms involved in development of kidney diseases and could lead to development of new treatment strategies.
| Acknowledgments |
|---|
Received May 17, 2005; first decision May 18, 2005; accepted June 20, 2005.
| References |
|---|
|
|
|---|
2. Bassett MH, White PC, Rainey WE. The regulation of aldosterone synthase expression. Mol Cell Endocrinol. 2004; 31: 217: 6774.
3. McFarlane SI, Sowers JR. Cardiovascular endocrinology 1: aldosterone function in diabetes mellitus: effects on cardiovascular and renal disease. J Clin Endocrinol Metab. 2003; 88: 516523.
4. Ye P, Kenyon CJ, MacKenzie SM, Seckl JR, Fraser R, Connell JM, Davies E. Regulation of aldosterone synthase gene expression in the rat adrenal gland and central nervous system by sodium and angiotensin II. Endocrinology. 2003; 144: 33213328.
5. Bureik M, Lisurek M, Bernhardt R. The human steroid hydroxylases CYP1B1 and CYP11B2. Biol Chem. 2002; 383: 15371551.[Medline] [Order article via Infotrieve]
6. Sato A, Hayashi K, Naruse M, Saruta T. Effectiveness of aldosterone blockade in patients with diabetic nephropathy. Hypertension. 2003; 41: 6468.
7. White PC. Aldosterone: direct effects on and production by the heart. J Clin Endocrinol Metab. 2003; 88: 23762383.
8. Rocha R, Stier CT Jr, Kifor I, Ochoa-Maya MR, Rennke HG, Williams GH, Adler GK. Aldosterone: a mediator of myocardial necrosis and renal arteriopathy. Endocrinology. 2000; 141: 38713878.
9. Gomez-Sanchez EP, Ahmad N, Romero DG, Gomez-Sanchez CE. Is aldosterone synthesized within the rat brain? Am J Physiol Endocrinol Metab. 2005; 288: E342346.
10. Sato A, Saruta T. Aldosterone breakthrough during angiotensin-converting enzyme inhibitor therapy. Am J Hypertens. 2003; 16: 781788.[CrossRef][Medline] [Order article via Infotrieve]
11. Ambroisine ML, Milliez P, Nehme J, Pasquier AL, De Angelis N, Mansier P, Swynghedauw B, Delcayre C. Aldosterone and anti-aldosterone effects in cardiovascular diseases and diabetic nephropathy. Diabetes Metab. 2004; 30: 311318.[Medline] [Order article via Infotrieve]
12. Rachmani R, Slavachevsky I, Amit M, Levi Z, Kedar Y, Berla M, Ravid M. The effect of spironolactone, cilazapril and their combination on albuminuria in patients with hypertension and diabetic nephropathy is independent of blood pressure reduction: a randomized controlled study. Diabet Med. 2004; 21: 471475.[CrossRef][Medline] [Order article via Infotrieve]
13. de Azevedo MJ, Ramos OL, Gross JL. Renin-aldosterone axis in normoalbuminuric insulin-dependent diabetes mellitus patients with glomerular hyperfiltration. Diabetes Res Clin Pract. 1995; 27: 205210.[CrossRef][Medline] [Order article via Infotrieve]
14. de Chatel R, Weidmann P, Flammer J, Ziegler WH, Beretta-Piccoli C, Vetter W, Reubi FC. Sodium, renin, aldosterone, catecholamines, and blood pressure in diabetes mellitus. Kidney Int. 1977; 12: 412421.[Medline] [Order article via Infotrieve]
15. Ferriss JB, OHare JA, Kelleher CC, Sullivan PA, Cole MM, Ross HF, OSullivan DJ. Diabetic control and the renin-angiotensin system, catecholamines, and blood pressure. Hypertension. 1985; 7: II58II63.[Medline] [Order article via Infotrieve]
16. Cronin CC, Barry D, Crowley B, Ferriss JB. Reduced plasma aldosterone concentrations in randomly selected patients with insulin-dependent diabetes mellitus. Diabet Med. 1995; 12: 809815.[Medline] [Order article via Infotrieve]
17. Perez GO, Lespier L, Jacobi J, Oster JR, Katz FH, Vaamonde CA, Fishman LM. Hyporeninemia and hypoaldosteronism in diabetes mellitus. Arch Intern Med. 1977; 137: 852855.
18. Beretta-Piccoli C, Weidmann P, Fraser R. Responsiveness of plasma 18-hydroxycorticosterone and aldosterone to angiotensin II or corticotropin in nonazotemic diabetes mellitus. Diabetes. 1983; 32: 15.[Abstract]
19. Luik PT, Kerstens MN, Hoogenberg K, Navis GJ, Dullaart RP. Low plasma aldosterone despite normal plasma renin activity in uncomplicated type 1 diabetes mellitus: effects of RAAS stimulation. Eur J Clin Invest. 2003; 33: 787793.[CrossRef][Medline] [Order article via Infotrieve]
20. Batlle DC. Sodium-dependent urinary acidification in patients with aldosterone deficiency and in adrenalectomized rats: effect of furosemide. Metabolism. 1986; 35: 852860.[Medline] [Order article via Infotrieve]
21. Siragy HM, Xue C, Abadir P, Carey RM. Angiotensin subtype-2 receptors inhibit renin biosynthesis and angiotensin II formation. Hypertension. 2005; 45: 133137.
22. Xue C, Johns RA. Histochemical evidence of endothelial nitric oxide synthase in vascular endothelium of patients with abnormally thickened pulmonary arteries. N Engl J Med. 1995; 333: 16421644.
23. Xue C, Botkin SJ, Johns RA. Endothelial NOS is postnatally expressed and localized at the basal microtubule membrane in ciliated epithelium of rat lung. J Histochem Cytochem. 1996; 44: 463471.[Abstract]
24. Xue C, Johns RA. The up-regulation of NOS correlates temporally with the development and degree of pulmonary vascular remodeling in hypoxic rats. Hypertension. 1996; 28: 743753.
25. Takeda Y. Vascular synthesis of aldosterone: role in hypertension. Mol Cell Endocrinol. 2004; 217: 7579.[CrossRef][Medline] [Order article via Infotrieve]
26. Gomez-Sanchez EP, Ahmad N, Romero DG, Gomez-Sanchez CE. Origin of aldosterone in the rat heart. Endocrinology. 2004; 145: 47964802.
27. Kayes-Wandover KM, White PC. Steroidogenic enzyme gene expression in the human heart. J Clin Endocrinol Metab. 2000; 85: 25192525.
28. MacKenzie SM, Clark CJ, Fraser R, Gomez-Sanchez CE, Connell JM, Davies E. Expression of II beta-hydroxylase and aldosterone synthase genes in the rat brain. J Mol Endocrinol. 2000; 24: 321328.[Abstract]
29. Siragy HM, Vieweg WV, Pincus S, Veldhuis JD. Increased disorderliness and amplified basal and pulsatile aldosterone secretion in patients with primary aldosteronism. J Clin Endocrinol Metab. 1995; 80: 2833.[Abstract]
30. Siragy HM, Awad A, Abadir P, Webb R. The angiotensin II type I receptor mediates renal interstitial content of tumor necrosis factor-alpha in diabetic rats. Endocrinology. 2003; 144: 22292233.
This article has been cited by other articles:
![]() |
S. H. Lee, T.-H. Yoo, B.-Y. Nam, D. K. Kim, J. J. Li, D.-S. Jung, S.-J. Kwak, D.-R. Ryu, S. H. Han, J. E. Lee, et al. Activation of local aldosterone system within podocytes is involved in apoptosis under diabetic conditions Am J Physiol Renal Physiol, November 1, 2009; 297(5): F1381 - F1390. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Becker, T. D. Hewitson, and A. Chrysostomou Aldosterone in clinical nephrology--old hormone, new questions Nephrol. Dial. Transplant., August 1, 2009; 24(8): 2316 - 2321. [Full Text] [PDF] |
||||
![]() |
A. Whaley-Connell, J. Habibi, Y. Wei, A. Gutweiler, J. Jellison, C. E. Wiedmeyer, C. M. Ferrario, and J. R. Sowers Mineralocorticoid receptor antagonism attenuates glomerular filtration barrier remodeling in the transgenic Ren2 rat Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1013 - F1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cortinovis, N. Perico, D. Cattaneo, and G. Remuzzi Aldosterone and progression of kidney disease Therapeutic Advances in Cardiovascular Disease, April 1, 2009; 3(2): 133 - 143. [Abstract] [PDF] |
||||
![]() |
G. Remuzzi, D. Cattaneo, and N. Perico The Aggravating Mechanisms of Aldosterone on Kidney Fibrosis J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1459 - 1462. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Siragy and C. Xue Local renal aldosterone production induces inflammation and matrix formation in kidneys of diabetic rats Exp Physiol, July 1, 2008; 93(7): 817 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Siragy, T. Inagami, and R. M. Carey NO and cGMP mediate angiotensin AT2 receptor-induced renal renin inhibition in young rats Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1461 - R1467. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Fujihara, D. M. A. C. Malheiros, and R. Zatz Losartan-hydrochlorothiazide association promotes lasting blood pressure normalization and completely arrests long-term renal injury in the 5/6 ablation model Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1810 - F1818. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Rump Secondary rise of albuminuria under AT1-receptor blockade--what is the potential role of aldosterone escape? Nephrol. Dial. Transplant., January 1, 2007; 22(1): 5 - 8. [Full Text] [PDF] |
||||
![]() |
M. P. Ponda and T. H. Hostetter Aldosterone Antagonism in Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., July 1, 2006; 1(4): 668 - 677. [Full Text] [PDF] |
||||
![]() |
D. Gu, S. Su, D. Ge, S. Chen, J. Huang, B. Li, R. Chen, and B. Qiang Association Study With 33 Single-Nucleotide Polymorphisms in 11 Candidate Genes for Hypertension in Chinese Hypertension, June 1, 2006; 47(6): 1147 - 1154. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |