This Article Abstract Full Text (PDF) Correction (v47,pe9) Correction (v47,pe9) All Versions of this Article: 46/4/758    most recent 01.HYP.0000186240.81996.57v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Turner, S. T. Articles by Boerwinkle, E. Search for Related Content PubMed PubMed Citation Articles by Turner, S. T. Articles by Boerwinkle, E. Related Collections Clinical genetics Clinical Studies Other Treatment Related Article

(Hypertension. 2005;46:758.)
© 2005 American Heart Association, Inc.

Original Articles

WNK1 Kinase Polymorphism and Blood Pressure Response to a Thiazide Diuretic

Stephen T. Turner; Gary L. Schwartz; Arlene B. Chapman; Eric Boerwinkle

From the Division of Nephrology and Hypertension, Department of Internal Medicine, Mayo Clinic and Foundation, Rochester, Minn (G.L.S., S.T.T.); Renal Division, Emory University, Atlanta, Ga (A.B.C.); and Institute of Molecular Medicine and Human Genetics Center, University of Texas Health Sciences Center, Houston (E.B.).

Correspondence to Stephen T. Turner, MD, Mayo Clinic, 200 First St SW, Rochester, MN 55905. E-mail turner.stephen{at}mayo.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Single nucleotide polymorphisms (SNPs) in genes encoding or influencing renal sodium transport systems were investigated as potential predictors of blood pressure (BP) response to a thiazide diuretic. A sample of 585 adults with essential hypertension (30 to 59.9 years of age; 50% blacks; 47% women) were treated with hydrochlorothiazide for 4 weeks (25 mg daily, orally) to determine office BP responses. Ambulatory BP responses were measured in a subset of 228 subjects. After adjustment for ethnicity, sex, age, and waist-to-hip ratio, 3 SNPs in WNK1 (rs2107614, rs2277869, and rs1159744), encoding a lysine-deficient protein kinase that regulates thiazide-sensitive sodium-potassium cotransport, made statistically significant contributions to predicting ambulatory BP responses, accounting for 2% to 4% of variation in systolic and diastolic responses (P<0.05). SNPs in the ß₂-adrenoceptor (rs2400707) and the epithelial sodium channel -subunit (rs5723 and rs5729) were associated with similar magnitude of variation in ambulatory systolic BP response (P=0.028) or office diastolic BP response (P<0.05), respectively. However, SNPs evaluated in the furosemide-sensitive sodium-potassium chloride cotransporter, potassium inwardly rectifying channel, chloride channel, thiazide-sensitive sodium chloride cotransporter, epithelial sodium channel ß-subunit, and the mineralocorticoid receptor were not associated with significant variation in ambulatory or office BP responses. Polymorphisms in genes regulating renal sodium transport, in particular WNK1, predict interindividual differences in antihypertensive responses to hydrochlorothiazide.

Key Words: polymorphism • genetics • diuretics • blood pressure

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The objective of the present study was to assess whether common variation in genes (polymorphisms) influencing renal tubular sodium transport may predict interindividual differences in blood pressure (BP) response to a thiazide diuretic. Among sodium transporters expressed in the thick ascending limb of Henle’s loop, we investigated polymorphisms in the furosemide-sensitive sodium-potassium chloride cotransporter SLC12A1, the potassium inwardly rectifying channel KCNJ1, and the chloride channel CLCNKB. Among distal nephron systems, we investigated polymorphisms in the thiazide-sensitive sodium chloride cotransporter SLC12A3; the lysine-deficient protein kinases 1 and 4, WNK1 and WNK4, that regulate thiazide-sensitive sodium chloride cotransport; the ß- and -subunits of the epithelial sodium channel, SCNN1B and SCNN1G; and the mineralocorticoid receptor NR3C2. Rare variants in these genes (mutations) cause monogenic forms of hypertension (or hypotension) by increasing (or decreasing) renal tubular sodium reabsorption, leading to volume expansion (or contraction) and secondary suppression (or stimulation) of plasma renin activity.¹ A secondary objective was to assess the effects of additional polymorphisms in -adducin and genes of the renin-angiotensin-aldosterone (RAA) and adrenergic nervous systems that were implicated previously as influencing renal sodium transport or BP response to diuretics.^2–5

	Methods

Top Abstract Introduction Methods Results Discussion References

 
The sample consisted of 291 unrelated non-Hispanic black adults (150 women and 141 men) from Atlanta, Ga, and 294 unrelated non-Hispanic white adults (126 women and 168 men) from Rochester, Minn, 30 to 59.9 years of age, with previously diagnosed essential hypertension uncomplicated by other illness. Study candidates were identified in Atlanta from lists of registered voters and other clinic, hospital, and community-based sources, and in Rochester, from a diagnostic index of residents of Olmsted County.^2,6 For inclusion, subjects were required to have systolic and diastolic BP <180 and 110 mm Hg, respectively, and no contraindications to stopping drugs that could influence BP level or other measurements. Postmenopausal women were allowed to continue hormone replacement therapy. Participants signed a consent form, and human studies review boards approved all study procedures, which were performed in the General Clinical Research Center (GCRC) of each institution in accordance with institutional guidelines.

Protocol
Subjects had their medications withdrawn and were instructed by a GCRC dietitian to ingest a sodium intake of 2 mmol per kg body weight per day. At a minimum of 4 weeks after stopping previous antihypertensive drugs, 25 mg of hydrochlorothiazide was given orally each day for 4 weeks. Body weight, BP, 24-hour urine excretion of potassium and aldosterone, and serum potassium concentration were measured after 2 and 4 weeks of treatment. Oral potassium supplements (20 to 40 mmol/L per day) were prescribed after 2 weeks if serum potassium was <3.6 mmol/L^–1. At the end of the drug-free and treatment periods, subjects slept overnight in the GCRC. At approximately 6 AM the next morning, blood for measurement of plasma aldosterone concentration and renin activity was drawn from subjects in the seated position after a 30-minute period of ambulation.

At each study visit, BP was measured between 7 and 9 AM in the subject’s dominant arm with a random-zero sphygmomanometer (Hawksley and Sons, Ltd). An initial reading was obtained after 5 minutes of rest in the sitting position, followed by 2 additional readings at 2-minute intervals, the average of which was used as the office BP level. In a subset of 116 black subjects (57 women and 59 men) and 112 non-Hispanic white subjects (26 women and 86 men) who agreed also to undergo ambulatory BP monitoring, technically satisfactory recordings were obtained at the end of the drug-free and diuretic therapy periods. SpaceLabs monitoring equipment (model 90202) was applied and removed on consecutive mornings between 7 and 9 AM just after the office BP readings. Subjects were required to go to bed at 10 PM (in the GCRC) and arise at 6 AM but otherwise not to lie down or nap during the BP recording. In Atlanta, the mean (±SD) number of BP measurements recorded before and after treatment was 63±4 (range 44 to 70) and 62±5 (range 39 to 68), respectively, and in Rochester, 124±13 (range 75 to 139) and 123±10 (range 92 to 140), respectively. For each recording, the mean of all readings was used as the ambulatory BP level. Responses to hydrochlorothiazide were calculated as differences between post-treatment and pretreatment BP levels.

Laboratory Procedures
We selected single nucleotide polymorphisms (SNPs) for genotyping from the National Center for Biotechnology Information (NCBI) database of SNPs (dbSNP) and the Celera Discovery System database (see Table 2). To characterize as much variation within each candidate gene as possible, we sought (in descending order of preference) SNPs causing nonsynonymous or synonymous changes in exons, SNPs in potential regulatory regions, and SNPs in introns. Celera identifiers, beginning with the letters "cv," are given only for those SNPs not found in the NCBI database. Otherwise, only the dbSNP reference identifier, beginning with the letters "rs," is used. For WNK1, which is located on chromosome 12p13.3 0.62 cM from pter, the rs2286007 CT polymorphism is in exon 8 at position 841 552, resulting in isoleucine instead of threonine at amino acid 665, and can be found by a match to the sequence TCAGGGATCCTCTGTCTTCA[C/T]AGAATCTCGAGTGAGCAGCC, in which brackets surround the variable nucleotide. Relationships between the other WNK1 SNPs, which are intronic, are depicted in Figure 1.

View this table: [in this window] [in a new window]   TABLE 2. Genotype and Allele Frequencies

View this table: [in this window] [in a new window]   TABLE 2. Continued

View larger version (22K): [in this window] [in a new window]   Figure 1. Relative chromosomal positions of SNPs genotyped in the protein kinase with no lysine (K) 1 gene, WNK1, on chromosome 12p13.3. Position of exon 8 is denoted by a horizontal box straddling SNP rs2286007. Linkage disequilibrium between SNPs is measured by r2 values7 (blacks/non-Hispanic whites), the statistical significance of which is indicated by: *P0.05; P0.01; P0.001; P0.0001.

The selected SNPs were genotyped using the MassARRAY System, which employs polymerase chain reaction amplification, followed by an allele-specific ligation reaction, matrix-assisted laser desorption time of flight allele detection, and genotype calling with proprietary software (Sequenom). The sequences of all primers and probes are available from the authors on request. Aldosterone concentration and renin activity were determined by radioimmunoassays as described previously.²

Statistical Methods
For quantitative traits, the 1-way ANOVA was used to contrast means (±SD) across groups, followed by Scheffe’s multiple pairwise comparisons between groups. For categorical traits, ² contingency tests were used to assess differences in relative frequencies between groups. Linear regression modeling was used to assess the associations of BP responses with genotypes after adjustment for covariates, including ethnicity, gender, age, waist-to-hip ratio, and baseline BP. Analyses were performed after pooling sexes and ethnic groups when there was no evidence of interactions with genotype. To explore possible epistatic effects of SNPs within genes, pairwise linkage disequilibrium between SNPs in a gene were calculated using the GOLD software package,⁷ and haplotypes were inferred using the PHASE 2.0 software package.⁸ All statistical analyses were performed using SAS 8 (SAS Institute Inc.). Test statistics with P values 0.05 were considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
The mean age of subjects varied from 47.7±5.7 (black women) to 49.7±6.4 years (white women; Table 1). Of 35 sites assessed in 16 genes, 23 were polymorphic in both ethnic groups (ie, relative frequency of less common allele >1%), 1 was not polymorphic in blacks, 6 were not polymorphic in whites, and 5 were not polymorphic in either ethnic group (Table 2). For the 23 sites that were polymorphic in both ethnic groups, genotype frequencies of 16 SNPs differed significantly between ethnic groups.

View this table: [in this window] [in a new window]   TABLE 1. Descriptive Characteristics

In the 228 subjects who underwent ambulatory BP monitoring, the covariates, including ethnicity, sex, age, waist-to-hip ratio, and baseline BP accounted for 23% and 20%, respectively, of interindividual variation in ambulatory systolic and diastolic BP responses. In comparison, these covariates accounted for 26% and 11%, respectively, of interindividual variation in office systolic and diastolic BP responses.⁹

Three of the 4 SNPs in WNK1 were associated with statistically significant differences in ambulatory BP responses after adjustment for the covariates (Table 3; Figure 2). The additional percentage of variation in BP responses explained by each SNP ranged between 2% and 4%. These associations were directionally consistent not only across systolic and diastolic BP responses (Table 3) but also across daytime and nighttime recording periods and across ethnic groups (data not shown). For the rs1159744 GC polymorphism, the covariate-adjusted mean decline in ambulatory systolic/diastolic BP was 7.2/3.6 mm Hg greater in CC than TT homozygotes (Table 3). When all 3 SNPs were forced into the same linear regression model, only the rs2277869 TC polymorphism made an additional (ie, independent) contribution to the prediction of BP responses; consideration of haplotypes constructed from the 3 linked SNPs (Figure 1) did not significantly improve the prediction of BP responses.

View this table: [in this window] [in a new window]   TABLE 3. Models Predicting Ambulatory BP Response to Hydrochlorothiazide

View larger version (17K): [in this window] [in a new window]   Figure 2. Mean decline in whole day ambulatory BP level by WNK1 rs1159744 genotype, adjusted for ethnicity, gender, age, waist-to-hip ratio, and baseline (pretreatment) BP level.

In separate models predicting baseline BP level, serum concentrations of potassium and aldosterone, plasma renin activity, and urinary excretion of potassium and aldosterone, only the rs1159744 GC polymorphism was associated with statistically significant differences in urinary potassium excretion at the end of diuretic therapy (Figure 3; in blacks, P=0.200; in non-Hispanic whites, P=0.049). The fourth WNK1 SNP (rs2286007) was not significantly associated with ambulatory BP responses in non-Hispanic whites (analyses not shown), and this site was not polymorphic in blacks (Table 2 ). Similarly, a SNP in WNK4 (cv1588330) was not significantly associated with ambulatory BP responses in blacks (data not shown), and this site was not polymorphic in whites (Table 2). None of the WNK1 or WNK4 polymorphisms were significantly associated with office BP responses to hydrochlorothiazide when analyzed 1 at a time or as multilocus haplotypes.

View larger version (10K): [in this window] [in a new window]   Figure 3. Mean 24-hour urinary potassium excretion (UkV) at the end of hydrochlorothiazide treatment by WNK1 rs1159744 genotype.

Of the SNPs in other genes, the ß₂-adrenoceptor (ADRB2) rs2400707 GA polymorphism was significantly associated with ambulatory systolic but not diastolic BP response (Table 3) or with office BP responses (data not shown). Haplotypes constructed from the ADRB2 rs2400707 and rs1042714 SNPs, which were in linkage disequilibrium (P<0.0001), did not improve prediction of ambulatory or office BP responses. The epithelial sodium channel -subunit (SCNN1G) rs5723 CG polymorphism was significantly associated with office diastolic BP response (mean decline of –7.4 mm Hg in CC homozygotes versus –9.0 mm Hg in CG heterozygotes+GG homozygotes; P=0.018), as was the SCNN1G rs5729 TA polymorphism (mean decline of –7.3 mm Hg in TT homozygotes versus –9.0 mm Hg in AT heterozygotes+AA homozygotes; P=0.014). However, neither SNP was significantly associated with office systolic or ambulatory BP responses (data not shown).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Thiazide diuretics are the preferred initial therapy for hypertension.¹⁰ The BP-lowering response initially depends on reduction of intravascular fluid volume attributable to inhibition of renal tubular sodium reabsorption, which is subsequently opposed by counter-regulatory activities of the RAA system. Plasma renin activity is the only laboratory measurement that has been consistently associated with BP response to diuretic therapy.¹¹ An inverse relationship of renin with BP response to sodium and volume loss is one basis for the greater antihypertensive effect of diuretic therapy in groups characterized by lower plasma renin activity, such as blacks and the elderly.¹¹

Previously, we investigated whether polymorphisms in genes of the RAA system may predict BP response to a thiazide diuretic. We found that polymorphisms in the genes encoding angiotensinogen,⁴ angiotensin-converting enzyme,³ angiotensin II receptor type 1,⁴ endothelial NO synthase,⁹ and the ß₃-subunit of G-proteins² were associated with interindividual differences in BP response to a standard antihypertensive dose of hydrochlorothiazide. Nevertheless, most interindividual variation (>50%) remained unexplained after all identified genetic and nongenetic predictors of response were considered.⁶ In this study, we sought to evaluate more comprehensively polymorphic variation in genes encoding and regulating sodium transporters that may predict BP response to hydrochlorothiazide.

Of 30 SNPs in 16 genes evaluated, 3 of the 4 SNPs in WNK1 provided evidence of a mechanistically plausible relationship between genetic variation regulating renal tubular sodium reabsorption and BP response to hydrochlorothiazide. Mutations in 2 members of the WNK family of serine-threonine kinases, WNK1 and WNK4, cause familial hyperkalemic hypertension, also known as Gordon’s syndrome or pseudohypoaldosteronism type II (PHAII).¹² This low-renin, volume-expanded syndrome of hypertension is chloride dependent, responsive to thiazide diuretic therapy and phenotypically the mirror image of the sodium-wasting hypotensive syndrome of Gitelman, which results from loss-of-function mutation of the thiazide-sensitive sodium chloride cotransporter. In PHAII, sodium chloride cotransporter gain of function results from mutations in the regulatory WNK kinase pathway.¹² In some families, missense mutations in highly conserved regions of exons 7 and 17 of WNK4 abrogate negative regulation of surface expression of cotransporters, whereas in other families, large deletions in the first intron of WNK1 increase its expression, which prevents WNK4 kinase inhibition of the cotransporter.¹³ Of the 3 WNK1 SNPs that we found to be predictive of ambulatory BP responses to hydrochlorothiazide, only one (rs2107614) is located in intron 1. However, it was also in linkage disequilibrium with the other WNK1 SNPs measured across the gene (Figure 1), 2 of which showed similar evidence of association with ambulatory BP responses. Results of the multivariable regression analyses that considered multiple SNPs either additively or as haplotypes did not improve prediction of responses. Consequently, we cannot precisely locate the DNA variation within WNK1 responsible for the observed effects on ambulatory BP responses.

The WNK1 SNP that most consistently accounted for the largest percentage of variation in ambulatory systolic and diastolic BP responses (rs1159744) was also associated with differences in urinary potassium excretion at the end of diuretic therapy (Table 3; Figure 2). Because WNK kinases also regulate potassium ion secretion in the distal nephron,¹⁴ and a defect in secretion is seen in families with WNK1 mutations,¹² this observed association may be biologically plausible and consistent with the BP response associations. However, some study subjects received oral potassium supplements, and no differences were observed among the WNK genotypes in plasma concentrations or baseline urinary excretion of potassium before diuretic therapy. Also, markers of volume status such as plasma renin activity and aldosterone did not differ among WNK genotypes. We suspect that this paucity of other phenotypic differences associated with the WNK1 SNPs reflects their overall subtle phenotypic impact, unlike the distinct PHAII phenotypes caused by rare WNK mutations.

The SNPs in other genes we investigated showed less compelling or no evidence of association with BP responses to hydrochlorothiazide. In particular, a SNP in ADRB2 was significantly associated with ambulatory systolic but not diastolic BP response or with office BP responses, and 2 SNPs in SCNN1G were associated with office diastolic BP response but not systolic BP or ambulatory BP responses. Office BP responses to hydrochlorothiazide are only moderately correlated when measured in the same subjects on 2 different occasions (systolic response r=0.61; diastolic response r=0.64)¹⁵ or when correlated with ambulatory BP responses measured at the same time (systolic response r=0.51; diastolic response r=0.46).¹⁶ Hence, the observed SCNN1G SNP associations with office but not ambulatory BP responses may be less reliable. We also question the validity of the observed association of a single SNP in ADRB2 (of 4 measured in this and a previous study⁹) with ambulatory systolic but not diastolic BP response. We found no predictive effects of the additional RAA system and -adducin polymorphisms measured in this study. However, our SNP measurements represent only a small proportion of total variation in the genes, and the SNPs we measured may not be functional or in linkage disequilibrium with functional variation. For these reasons, negative results in the present study cannot exclude the possibility that variation in the genes may influence BP responses to hydrochlorothiazide.

Perspectives
Antihypertensive drug selection remains largely a trial and error process^17,18 that often fails to achieve adequate BP control.¹⁹ For a given antihypertensive drug, BP responses are distributed normally: the SD of responses is similar in magnitude to the mean response (5 to 10 mm Hg), and the range of responses is >4x the mean response.²⁰ Most of the variation in response is attributable to pharmacodynamic differences that reflect the heterogeneity of pathophysiologic mechanisms contributing to elevation of BP.²¹ Mapping and sequencing of the human genome, along with increasingly detailed characterization of SNPs genomewide, offer the promise that pharmacogenetic approaches may allow greater individualization and efficacy of antihypertensive therapy. Results from this study suggest that common variation in WNK1, encoding a lysine deficient protein kinase that regulates thiazide-sensitive sodium-potassium cotransport, predicts differences in BP to hydrochlorothiazide.

	Acknowledgments

 
This work was supported by US Public Health Service grants R01-HL53330, M01-RR00585, and M01-RR00039, and funds from the Mayo Foundation. We appreciate the staff and resources provided by the General Clinical Research Centers at Emory University and the Mayo Clinic and technical assistance provided by Joanne Ryan, Patricia Loftus, Jodie Van De Rostyne, and Zhiying Wang. A portion of this work was presented as an abstract at the American Society of Nephrology meeting and published in J Am Soc Nephrol (15:356A, 2004).

Received March 25, 2005; first decision April 18, 2005; accepted July 28, 2005.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Lifton RP, Gharavi AG, Geller DS. Molecular mechanisms of human hypertension. Cell. 2001; 104: 545–556.[CrossRef][Medline] [Order article via Infotrieve]

2. Turner ST, Schwartz GL, Chapman AB, Boerwinkle E. C825T polymorphism of the G protein beta(3)-subunit and antihypertensive response to a thiazide diuretic. Hypertension. 2001; 37: 739–743.[Abstract/Free Full Text]

3. Schwartz GL, Turner ST, Chapman AB, Boerwinkle E. Interacting effects of gender and genotype on blood pressure response to hydrochlorothiazide. Kidney Int. 2002; 62: 1718–1723.[CrossRef][Medline] [Order article via Infotrieve]

4. Frazier L, Turner ST, Schwartz GL, Chapman AB, Boerwinkle E. Multilocus effects of the renin-angiotensin-aldosterone system genes on blood pressure response to a thiazide diuretic. Pharmacogenomics J. 2004; 4: 17–23.[CrossRef][Medline] [Order article via Infotrieve]

5. Cusi D, Barlassina C, Azzani T, Casari G, Citterio L, Devoto M, Glorioso N, Lanzani C, Manunta P, Righetti M, Rivera R, Stella P, Troffa C, Zagato L, Bianchi G. Polymorphisms of alpha-adducin and salt sensitivity in patients with essential hypertension. Lancet. 1997; 349: 1353–1357.[CrossRef][Medline] [Order article via Infotrieve]

6. Chapman AB, Schwartz GL, Boerwinkle E, Turner ST. Predictors of antihypertensive response to a standard dose of hydrochlorothiazide for essential hypertension. Kidney Int. 2002; 61: 1047–1055.[CrossRef][Medline] [Order article via Infotrieve]

7. Abecasis GR, Cookson WO. GOLD-graphical overview of linkage disequilibrium. Bioinformatics. 2000; 16: 182–183.[Abstract/Free Full Text]

8. Stephens M, Donnelly P. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet. 2003; 73: 1162–1169.[CrossRef][Medline] [Order article via Infotrieve]

9. Turner ST, Chapman AB, Schwartz GL, Boerwinkle E. Effects of endothelial nitric oxide synthase, alpha-adducin, and other candidate gene polymorphisms on blood pressure response to hydrochlorothiazide. Am J Hypertens. 2003; 16: 834–839.[CrossRef][Medline] [Order article via Infotrieve]

10. Appel LJ. The verdict from ALLHAT—thiazide diuretics are the preferred initial therapy for hypertension. J Am Med Assoc. 2002; 288: 3039–3042.[Free Full Text]

11. Preston RA, Materson BJ, Reda DJ, Williams DW, Hamburger RJ, Cushman WC, Anderson RJ. Age-race subgroup compared with renin profile as predictors of blood pressure response to antihypertensive therapy. Department of Veterans Affairs Cooperative Study Group on Antihypertensive Agents. J Am Med Assoc. 1998; 280: 1168–1172.[Abstract/Free Full Text]

12. Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard JM, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, Lifton RP. Human hypertension caused by mutations in WNK kinases. Science. 2001; 293: 1107–1112.[Abstract/Free Full Text]

13. Yang CL, Angell J, Mitchell R, Ellison DH. WNK kinases regulate thiazide-sensitive Na-Cl cotransport. J Clin Invest. 2003; 111: 1039–1045.[CrossRef][Medline] [Order article via Infotrieve]

14. Kahle KT, Wilson FH, Lalioti M, Toka H, Qin H, Lifton RP. WNK kinases: molecular regulators of integrated epithelial ion transport. Curr Opin Nephrol Hypertens. 2004; 13: 557–562.[Medline] [Order article via Infotrieve]

15. Finkielman JD, Schwartz GL, Chapman AB, Boerwinkle E, Turner ST. Reproducibility of blood pressure response to hydrochlorothiazide. J Clin Hypertens (Greenwich). 2002; 4: 408–412.[Medline] [Order article via Infotrieve]

16. Finkielman JD, Schwartz GL, Chapman AB, Boerwinkle E, Turner ST. Lack of agreement between office in ambulatory blood pressure responses to hydrochlorothiazide. Am J Hypertens. 2005; 18: 389–402.

17. Major outcomes in high-risk hypertensive patients randomized to angiotensin-converting enzyme inhibitor or calcium channel blocker vs diuretic: The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). J Am Med Assoc. 2002; 288: 2981–2997.[Abstract/Free Full Text]

18. The sixth report of the Joint National Committee on prevention, detection, evaluation, and treatment of high blood pressure. Arch Intern Med. 1997; 157: 2413–2446.[Abstract/Free Full Text]

19. Meissner I, Whisnant JP, Sheps SG, Schwartz GL, O’Fallon WM, Covalt JL, Sicks JD, Bailey KR, Wiebers DO. Detection and control of high blood pressure in the community: Do we need a wake-up call? Hypertension. 1999; 34: 466–471.[Abstract/Free Full Text]

20. Turner ST, Schwartz GL, Chapman AB, Hall WD, Boerwinkle E. Antihypertensive pharmacogenetics: getting the right drug into the right patient. J Hypertens. 2001; 19: 1–11.[CrossRef][Medline] [Order article via Infotrieve]

21. Laragh JH, Lamport B, Sealey J, Alderman MH. Diagnosis ex juvantibus. Individual response patterns to drugs reveal hypertension mechanisms and simplify treatment. Hypertension. 1988; 12: 223–226.[Abstract/Free Full Text]

Related Article:

Corrections
Hypertension 2006 47: e9-e10. [Extract] [Full Text] [PDF]

This article has been cited by other articles:

				M. D. Tobin, N. J. Timpson, L. V. Wain, S. Ring, L. R. Jones, P. M. Emmett, T. M. Palmer, A. R. Ness, N. J. Samani, G. D. Smith, et al. Common Variation in the WNK1 Gene and Blood Pressure in Childhood: The Avon Longitudinal Study of Parents and Children Hypertension, November 1, 2008; 52(5): 974 - 979. [Abstract] [Full Text] [PDF]

				C. Richardson and D. R. Alessi The regulation of salt transport and blood pressure by the WNK-SPAK/OSR1 signalling pathway J. Cell Sci., October 15, 2008; 121(20): 3293 - 3304. [Abstract] [Full Text] [PDF]

				S. T. Turner, K. R. Bailey, B. L. Fridley, A. B. Chapman, G. L. Schwartz, H. S. Chai, H. Sicotte, J.-P. Kocher, A. S. Rodin, and E. Boerwinkle Genomic Association Analysis Suggests Chromosome 12 Locus Influencing Antihypertensive Response to Thiazide Diuretic Hypertension, August 1, 2008; 52(2): 359 - 365. [Abstract] [Full Text] [PDF]

				P. Manunta, G. Lavery, C. Lanzani, P. S. Braund, M. Simonini, C. Bodycote, L. Zagato, S. Delli Carpini, C. Tantardini, E. Brioni, et al. Physiological Interaction Between {alpha}-Adducin and WNK1-NEDD4L Pathways on Sodium-Related Blood Pressure Regulation Hypertension, August 1, 2008; 52(2): 366 - 372. [Abstract] [Full Text] [PDF]

				P.-a. B. Shih and D. T. O'Connor Hereditary Determinants of Human Hypertension: Strategies in the Setting of Genetic Complexity Hypertension, June 1, 2008; 51(6): 1456 - 1464. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Correction (v47,pe9) Correction (v47,pe9) All Versions of this Article: 46/4/758    most recent 01.HYP.0000186240.81996.57v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Turner, S. T. Articles by Boerwinkle, E. Search for Related Content PubMed PubMed Citation Articles by Turner, S. T. Articles by Boerwinkle, E. Related Collections Clinical genetics Clinical Studies Other Treatment Related Article