Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2005;46:787-798
Published online before print September 19, 2005, doi: 10.1161/01.HYP.0000184362.61744.c1
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/4/787    most recent
01.HYP.0000184362.61744.c1v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Other hypertension
Right arrow Ion channels/membrane transport

(Hypertension. 2005;46:787.)
© 2005 American Heart Association, Inc.


Original Articles

Androgen Receptor–Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney

Marcus Quinkler; Iwona J. Bujalska; Kirren Kaur; Claire U. Onyimba; Sabine Buhner; Bruno Allolio; Susan V. Hughes; Martin Hewison; Paul M. Stewart

From the Division of Medical Sciences (M.Q., I.J.B., K.K., C.U.O., S.V.H., M.H., P.M.S.), University of Birmingham, United Kingdom; Divisions of Clinical Endocrinology (M.Q.) and Gastroenterology, Hepatology, and Endocrinology (S.B.), Department of Medicine, Campus Mitte, Charité University-Medicine Berlin, Germany; and Department of Endocrinology (B.A.), Medical University Hospital Wuerzburg, Germany.

Correspondence to Paul M. Stewart, MD, FRCP, FMedSci, Professor of Medicine, Division of Medical Sciences, Institute of Biomedical Research, Medical School, University of Birmingham, Birmingham, B15 2TT UK. E-mail p.m.stewart{at}bham.ac.uk


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Rodents studies suggest that androgens are involved in sex-specific differences in blood pressure. In humans, there is no difference in blood pressure between boys and girls, but after puberty, blood pressure increases more in men than in women. We investigated androgen-dependent regulation of the {alpha}-subunit of the epithelial sodium channel ({alpha}EnaC) in human kidney and in the human renal cell line immortalized human renal proximal tubular cell line (HKC-8). We used microarray technique to analyze androgen-dependent gene regulation and performed quantitative RT-PCR for verification. Promoter constructs for human {alpha}ENaC were used in transfection studies to analyze the regulation by testosterone. We investigated the in vivo effect of testosterone on {alpha}ENaC in a rat model and used the mouse collecting duct cell line M-1 for transepithelial electrophysiological measurements. The androgen receptor (AR) was expressed in male kidney and HKC-8 cells. {alpha}ENaC mRNA expression increased 2- to 3-fold after treatment with testosterone in HKC-8 cells. The induction by testosterone was completely blocked by adding the AR antagonist flutamide. Analysis of the {alpha}ENaC promoter sequence identified a putative AR response element (ARE) located 140 nucleotides upstream from the transcription start site. HKC-8 cell transfection studies showed that testosterone directly upregulated gene expression via this ARE. In vivo, testosterone treatment of orchiectomized rats resulted in an increased renal {alpha}ENaC mRNA expression. In testosterone-treated mouse M-1 cells, amiloride caused a significant stronger decrease in short circuit current than in control cells. These data show that {alpha}ENaC expression is directly regulated by androgens in vitro and in vivo and highlight a potential mechanism explaining the reported gender differences in blood pressure.


Key Words: blood pressure • gender • kidney • sodium channels


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Androgens are known to play an important role in renal tubular epithelial cell growth, hypertrophy, and erythropoetin production, and may be important determinants of sex-specific differences in blood pressure.1 In spontaneously hypertensive rats, males have higher blood pressures than females,2 an effect that is reversed by male castration. Furthermore, increases in blood pressure were observed in castrated male and female rats after the administration of testosterone,2,3 whereas administration of the androgen receptor (AR) antagonist flutamide attenuated hypertension.4 These studies strongly implicate androgens in the regulation of blood pressure in the rat, but the mechanisms for this are still unknown.

In humans, there is no difference in blood pressure between boys and girls, but during and after puberty, boys show higher blood pressure than age-matched girls,5,6 and men have a higher overall mean arterial pressure than women,7 regardless of ethnic origin.8 The higher blood pressure and stronger progression of hypertension in men is associated with a higher risk and mortality for cardiovascular diseases than in women.9,10

Although androgens appear to play an important role in the pathogenesis of sex-specific differences in hypertension, it is clear that other sex steroids are also involved in the control of blood pressure. For example, estrogens are known to modulate vascular endothelial function, resulting in vasodilatation and lowering of blood pressure of women.11,12 The role of androgens in blood pressure regulation and the pathogenesis of hypertension have not been extensively investigated. Because the kidneys play a major role in the regulation of blood pressure,13 we used a human renal cell line and an in vivo rat model to investigate androgen effects on key target genes associated with renal sodium and water reabsorption.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Cells from the simian virus 40–infected human proximal tubule cell line (HKC-8)14 were cultured in standard culture medium (470 mL DMEM/Ham F12, 5 mL 2 mmol/L glutamine [all from Sigma Chemical Co], and 25 mL of FCS [Gibco Invitrogen Ltd] final concentration 5%) in 75 cm2 flasks. They were incubated at 37°C (95% O2 and 5% CO2) until they were confluent. HKC-8 cells were transferred to 12- or 24-well plates so that each well contained 1 mL ({approx}105 cells) of cell suspension in standard culture medium.

The mouse collecting duct cell line M-1 (American Type Culture Collection) was grown on cell culture inserts with a semipermeable membrane (positron emission tomography track–etched membrane with 0.4 µm pore size and 10.3 mm in diameter; Falcon; Becton Dickinson). The cultures were initially maintained in DMEM/Ham F12 medium with 2 mmol/L glutamine, 5% FCS, 50 U/mL penicillin, 50 mg/mL streptomycin, and 100 nmol/L dexamethasone. On the third day after seeding, the culture medium was changed to the identical media described above, except without FCS and without dexamethasone. Testosterone (100 nmol/L) or vehicle (ethanol) was added, and cells were incubated for 36 hours.

For primary kidney cell cultures of proximal tubular origin, epithelial cells from unaffected cortical fragments obtained from tumor nephrectomies were cultured using established methodologies.15 The study had the approval of the local research ethics committee, and written informed consent was obtained in every case before operation. All studies involving the use of humans were in accordance with institutional guidelines such as the Declaration of Helsinki and Title 45, US Code of Federal Regulations, Part 46, Protection of Human Subjects, Revised November 13, 2001, effective December 13, 2001.

Enzyme Assays
We investigated the metabolism of DHEA, androstenedione, and testosterone in HKC-8 cells. Before incubation, cells were washed with 0.5 mL of FCS-free DMEM/Ham F12, then 1 mL of serum-free incubation medium was added. All incubations were done in triplicates. Preliminary experiments were done for the incubation time (4 to 24 hours). For incubations with 150 000cpm of 3H-DHEA, 3H-testosterone, or 3H-androstenedione (all from Amersham Biosciences), we added 50 nmol/L of unlabeled DHEA, testosterone, or androstenedione (all from Sigma Chemical Co.), respectively. These were incubated for 10 hours at 37°C.

Steroid Extraction and Detection
The incubations were terminated by freezing and thawing of the incubation plate, and the cells were scraped from the surface of the wells. The cell solution from each of the wells was transferred to borosilicate glass vials (Pyrex Corning Inc), and steroids were extracted with 5 mL of dichloromethane. For steroid detection, radioactive probes were run on a thin-layer chromatography (TLC) plate (20x20 cm TLC aluminum plates coated with silica gel 60F254; Fluka Chemika) along with unlabeled control steroids and detected as described previously.16 Briefly, the plates were run in a mixture of dichloromethane:acetone (92.5:7.5) for 75 minutes. After drying at room temperature for 10 minutes, they were run for an additional 45 minutes in the same mixture and the same direction. After the run, plates were scanned by a Bioscan 3000 image analyzer (Bioscan Inc.) then sprayed with Liebermann-Bourchard reagent and heated for detection of unlabeled control steroids under UV light (360 nm). The running distance of each control steroid was compared with the running distance of the radiolabeled steroids for identification of the metabolites in the sample. Percentage conversions were calculated using radiolabeled spots that had been detected. The Bio-Rad protein assay (Bio-Rad) was performed to determine the concentration of total protein.

RNA Extraction and RT-PCR
Total RNA was extracted using a single-step extraction method (Tri reagent; Sigma). RNA integrity was assessed by electrophoresis on 1% agarose gels and quantity determined spectrophotometrically at optical density at 260 nm. Next, 1 µg of total RNA was reverse transcribed as reported previously.16 Analysis of mRNA expression was performed using the primers shown in Table 1. Specific PCRs (20 µL) were set up as described previously.16 Samples were amplified using initial denaturation of 94°C for 5 minutes followed by 34 cycles (38 cycles for kidney sodium bicarbonate cotransporter 1 [kNBC-1]) of 94°C (30 s), 60°C (30 s), and 72°C (30 s), and a final elongation step of 72°C for 7 minutes. Amplification products were run by electrophoresis in 1.5% agarose gels stained with ethidium bromide. We used human testis, liver, and kidney cDNA as positive controls (see Figures 2 and 3Down).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Primer Sequences and Product Size of Target Genes



View larger version (80K):
[in this window]
[in a new window]
 
Figure 2. Expression of androgen-metabolizing enzymes in human renal cell line HKC-8. Typical RT-PCR analysis of 17ß-HSD5 and 5{alpha}-reductases. M indicates ladder; neg, negative control; ki, human kidney; li, human liver; HCD, human collecting duct cell line.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 3. Expression of genes associated with sodium homeostasis in human renal cell line HKC-8. Typical RT-PCR analysis of MR, kNBC-1, NHE, 11ß-HSD2, sgk-1, and {alpha}ENaC. The 2 bottom panels show sgk-1 and {alpha}ENaC mRNA expression in 2 different stocks of HKC-8 cells. M indicates ladder; neg, negative control; ki, human kidney; li, human liver; HCD, human collecting duct cell line.

Western Immunoblot Analysis
Proteins were prepared from whole cell lysates, 1 male and 1 female kidney, as well from 2 primary kidney cell lines from male donors. Briefly, 40 µg of total protein for each sample was subjected to SDS-PAGE, transferred electrophoretically onto polyvinylidene fluoride membrane (Immobilon-P; Millipore), and blocked with TBS-Tween containing 5% milk powder for 1 hour. For detection of ARs, rabbit polyclonal antibodies (Santa Cruz Biotechnology Inc) were diluted 1:500 and membranes incubated overnight at 4°C. After a series of washes, the membranes were exposed to secondary anti-goat rabbit antibody (horseradish peroxidase conjugate; DAKO Ltd) with a dilution of 1:1000. Proteins were detected using enhanced chemiluminescence (ECL; Amersham) and autoradiography. AR blocking peptide (Santa Cruz Biotechnology Inc) was used to block the AR-specific band.

Microarray Analysis
HKC-8 cells were treated either with 500 nmol/L testosterone or with the corresponding amount of ethanol (steroid solvent) for 48 hours. RNAs from 4 treated cultures were pooled as well as RNAs from 4 control cultures. Biotin-labeled cRNA was generated from 10 µg of total RNA according to Affymetrix technical protocol (GeneChip Expression Analysis Manual). A total of 15 µg of cRNA was hybridized to Human Genome U133 sets (Affymetrix). Affymetrix software (Data Mining Tool; version 3.0) was used for analyzing microarray data. Actin and GAPDH were used to assess RNA samples and assay quality. Accordingly, results are presented as qualitative (detection) and quantitative (signal) measures of expression level, which represent arbitrary data, and comparisons between testosterone-treated and control cultures were expressed as fold change. The interassay variability between microarrays was <5%.

Quantitative RT-PCR
HKC-8 cells were treated for different times (0, 6, 12, 24, and 48 hours) with testosterone (500 nmol/L) as well as with different testosterone concentrations (0, 0.01, 0.05, 0.1, 0.5, 1, 10, 50, 100, 500, and 1000 nmol/L) for 48 hours in triplicates versus ethanol-treated control cultures. In addition, HKC-8 cells were treated with different concentrations (0.001, 0.1, 10, and 1000 µmol/L) of the AR antagonist flutamide (Sigma-Aldrich Company Ltd). In further experiments, HKC-8 cell cultures were treated in triplicates with different concentrations (0, 1, 10, and 100 nmol/L) of testosterone, 5{alpha}-dihydrotestosterone, or dexamethasone for 48 hours. All incubations were performed in FCS-free incubation media and repeated 3 times. RNA was extracted as mentioned above. The {alpha}-subunit of the epithelial sodium channel ({alpha}EnaC) and serum and glucocorticoid-regulated kinase 1 (sgk1) mRNA expression levels were analyzed using an ABI Prism 7700 sequence detection system (Perkin-Elmer Applied Biosystems) as described previously.16 All reactions were singleplexed with the housekeeping gene (18S). Oligonucleotide primers and a Taqman probe for {alpha}ENaC were as follows: forward, CCAGCTCTCTGCTGGTTACTCA; reverse, TCGCGATAGCATCTGGAAGA; and probe, TGGCCCTCGGTGACATCCCAG. The primers and probe used for sgk1 real-time PCR were a commercially available Assay on Demand (Applied Biosystems). According to manufacturer guidelines, data were expressed as threshold cycle value (of PCR amplification at which the product is first detected) (ct) values and used to determine dct values. Fold changes in expression were calculated according to the transformation: fold increase=2–difference in dct.

Regulatory Sequence Motif Search in the Predicted {alpha}ENaC Promoter Region
A search analysis of the sequence of the {alpha}ENaC mRNA (GenBank accession No. NM_001038.2) was conducted against the human genome, and 2 kb of the sequence upstream of the {alpha}ENaC starting side was used for analysis with TESS and the TRANSFAC 4.0 database.

Cloning, Transfection, and Functional Analysis of {alpha}ENaC Promoter–Reporter Constructs
Human genomic DNA was obtained from human renal HKC-8 cells using DNeasy Tissue Kit from Qiagen. Four different {alpha}ENaC promoter constructs were designed: construct 1 (no AR response element [ARE] sequence) and constructs 2 through 4 (with ARE sequence; see Figure 7A). They were directionally subcloned into pGL3 enhancer vector (Promega Corporation). For transient transfection of 50% to 70% confluent HKC-8 cells, we used 2 µL of Lipofectamine Reagent and 0.5 µg of total DNA in 200 µL OptiMeM (all Invitrogen, Life Technologies) per well for 4 hours. After transfection, the medium was changed to DMEM/Ham F12 with 5% FCS, and with 0, 1, 10, and 100 nmol/L testosterone or 100 nmol/L testosterone with or without 10 µmol/L flutamide, or with 0.5 nmol/L aldosterone or 100 nmol/L cortisol or 100 nmol/L 5{alpha}-dihydrotestosterone for 48 hours. The cells were harvested and assayed for firefly and renilla luciferase activity using Dual-Luciferase Reporter Assay System (Promega Corporation). Each construct was transfected into HKC-8 cells in quadruplicate for each concentration, and each well was assayed in duplicate for luciferase activity.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. A, Constructs 1 and 2 were transiently transfected into HKC-8 cells and treated with 100 nmol/L testosterone (T) in the presence or absence of AR antagonist flutamide (48-hour incubation). Luciferase activity levels (normalized by cotransfection with a renilla luciferase construct) were reported as fold increase compared with the corresponding construct (ctr) without steroid, which was set as 1. Means of quadruplicate incubations and duplicate measurements±SD. ***Significant (P<0.001) to ctr. B, Changes (percent) in luciferase activity of construct 2 (gray bars) and ARE mutant construct 2 (open bars) by increasing concentrations of testosterone. Means of quadruplicate incubations and duplicate measurements±SEM. *P<0.05 compared with the corresponding construct without steroid.

The putative testosterone-responsive enhancer in the 5'-flanking region of the human {alpha}ENaC gene AGAACAgaaTGTCCT was mutated to AGAACAgaaGACACT in construct 2 using the Quickchange Site-Directed Mutagenesis Kit (Stratagene) and primers 5'-CAACAGTGTAAAAAAGAACAGAAGACACTAGGCCCGCCTAGCCC and 5'-GGGCTAGGCGGGGCCCTAGTGTCTTCTGTTCTTTTTTACACTGTTG. The mutated construct 2 was transfected into HKC-8 cells and incubated with testosterone as described above.

Animal Experiments
Male Wistar rats aged 8 to 10 weeks with a body weight (bw) of 180 to 200 g were obtained from Charles River Breeding Laboratories (Kisslegg, Germany). All animal experimentation described was conducted in accordance with accepted standards of humane animal care such as the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. Animals received water and normal rat chow ad libitum. They were orchiectomized and treated with a long-lasting testosterone preparation (testosterone undecanoate; 100 or 500 mg/kg bw), with a 5{alpha}-dihydrotestosterone preparation (75 mg per pellet per 21-day release), or with placebo.17,18 Each group consisted of 4 animals. After 14 days, the animals were killed and the kidneys removed. RNA was extracted and quantitative real-time PCR performed as described above.

Electrophysiological Transepithelial Measurements
The mouse cell line M-1 was grown on inserts with a semipermeable membrane. After incubating the confluent M-1 cells, the semipermeable membrane was mounted in a 4-electrode Ussing chamber separating the apical and basolateral compartment. The 2 compartments were filled with a solution containing 140 mmol/L sodium, 123.8 mmol/L chloride, 5.4 mmol/L potassium, 1.2 mmol/L calcium, 1.2 mmol/L magnesium, 2.4 mmol/L HPO42–, 0.6 mmol/L H2PO4, 21 mmol/L HCO3, 10 mmol/L D(+)-glucose, 0.5 mmol/L ß-hydroxybutyrate, 2.5 mmol/L glutamine, 10 mmol/L D(+)-mannose, and antibiotics (10 mg/L imipenem/cilastatin and 50 mg/L azlocillin) and continuously bubbled with 95% O2 and 5% CO2 at 37°C. After a period of equilibrium (1 to 2 hours), periodic measurements of transepithelial resistance (Rte), voltage (Vte), and short circuit current (Ieq) were obtained once every 30 s using a computer-controlled voltage-clamp device (CVC 6; Fiebig). Ieq values were corrected for bath resistance. Once baseline readings had stabilized, 10 µmol/L amiloride (Sigma Chemical Co) was added to the apical compartment. Ieq values over a period of 10 minutes before and after amiloride were averaged and compared for change in Ieq attributable to amiloride. Control of electrophysiological function of M-1 cells was performed by evaluating the response to theophylline (Sigma Chemical Co).

Statistical Analysis
Data are expressed as mean±SD unless otherwise stated. Statistical analysis on real-time PCR data were performed on mean dct values (and not on fold changes) to exclude potential bias attributable to averaging data that had been transformed through the equation 2–ct. Statistical analysis of comparisons between groups was undertaken using paired and unpaired t tests where appropriate; otherwise, the Mann–Whitney rank sum test or ANOVA Bonferroni was used.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Renal AR Expression
RT-PCR analysis showed strong expression of mRNA for the ARs in HKC-8 cells as well as in T47D (breast epithelial) cells (Figure 1A). AR mRNA was also detected in kidney and 2 primary kidney cell cultures from male donors; whereas in a single "female" kidney, the signal was minimal. Western blot analysis confirmed the strong expression of AR in HKC-8 cells as well as in T47D cells (Figure 1B). Kidneys from 3 males showed positive protein detection, whereas no AR protein was found in the kidney from a female (Figure 1B).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 1. A, AR mRNA expression in male (m) and female (f) kidney (ki), proximal kidney cell line HKC-8, T47D cell line, and 2 primary kidney cell lines (p.c.) from male donors. M indicates ladder. B, AR protein expression with Western blot analysis. Right panel, AR blocking peptide was used.

Enzyme Assay and Enzyme Expression
Previous studies have reported androgen synthesis and metabolism in human kidney tissue.19 Therefore, we investigated androgen metabolism in the human renal cell line HKC-8. There was no significant metabolism of DHEA or testosterone in HKC-8 cells (data not shown). HKC-8 cells showed expression of 17ß-hydroxysteroid dehydrogenase type 2 (17ß-HSD2) and 17ß-HSD4 mRNAs but not 17ß-HSD1 and 17ß-HSD5 (Figure 2). Androstenedione was metabolized to the single metabolite 5{alpha}-androstanedione (data not shown) by 5{alpha}-reductase 1, which was highly expressed in all kidney tissues (Figure 2). Surprisingly, testosterone was not converted to 5{alpha}-dihydrotestosterone in HKC-8 cells, probably because first, the micromolar Km value of 5{alpha}-reductase 1 for testosterone, and second, the lack of 5{alpha}-reductase 2 expression. Subsequently, in functional studies, we incubated HKC-8 cells with testosterone.

The HKC-8 cells derive originally from a proximal tubule cell line, and therefore, we tested their enzyme, ion transporter, and receptor expression. These cells showed features of polarization such as the formation of domes indicative of transepithelial transport. HKC-8 cells typically expressed channels of the proximal tubule, such as the basolateral electrogenic Na+-HCO3 cotransporter kNBC-1 and the luminal Na+-H+ exchangers NHE-2 and NHE-3 (Figure 3), which have both been implicated in apical sodium absorption. However, the cell line also showed features characteristic of distal tubule cells, including expression of mRNA for mineralocorticoid receptor (MR), sgk1, {alpha}ENaC, and 11ß-HSD2 (Figure 3), and abundant 11ß-HSD2 activity (conversion of cortisol to cortisone [4 pmol/mg protein per hour]). Although there was abundant {alpha}ENaC expression (Figure 3), ßENaC and {gamma}ENaC expression was not identifiable in HKC-8 cells under basal conditions (data not shown).

Microarray Analysis
To assess the effects of testosterone on gene expression in HKC-8 cells, DNA microarray analysis was performed using mRNA isolated from vehicle- and testosterone-treated (500 nmol/L) cells. Data from primary and comparison files (testosterone-treated versus control) on HKC-8 cells were analyzed, and candidate genes were selected using Microarray Suite 5.0 (Affymetrix). A total of 22 283 (U133A) entries in comparison analysis were sorted out according to the criteria: (1) genes with absent signal in control and treated cells arrays were deleted; (2) genes with difference signal of no change were deleted; (3) genes with signal log ratio <1 for increase or above –1.0 for decrease were deleted (arbitrary cutoff point of 2-fold change); and (4) expressed sequence tag entries were not analyzed. This filtering procedure resulted in a single data set testosterone-treated versus control with changes in gene expression of ≥2-fold.

Incubation of HKC-8 cells with testosterone for 48 hours resulted in significant changes (≥2-fold) in 9 genes on U133A microarrays, downregulation of 6, and upregulation of 3 genes (Table 2). {alpha}ENaC was significantly upregulated (2-fold) by testosterone in HKC-8 cells. The microarray analysis confirmed that ßENaC and {gamma}ENaC are not expressed under basal conditions in HKC-8 cells and were not regulated by testosterone (Table 2). The AR and sgk were present under basal conditions but showed no change after testosterone treatment (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Expression of Genes According to cDNA Arrays With RNA Extracted From Control HKC-8 Cells and Testosterone (500 nmol/L)-Treated HKC-8 Cells

Quantitative PCR
To confirm that the Affymetrix DNA microarrays accurately identified {alpha}ENaC gene expression changes, we performed separate quantitative RT-PCR assays. Expression of {alpha}ENaC mRNA increased significantly after 6-hour treatment with testosterone and reached a highly significant level (2.5-fold induction) at 48 hours (Figure 4A). Dose dependency of testosterone response was evident (Figure 4B), with IC50=10 nmol/L. The highest increase in {alpha}ENaC expression (3.5-fold) was observed using testosterone concentrations between 50 and 100 nmol/L (Figure 4B). In comparison, 100 nmol/L of dexamethasone resulted in a 4.5-fold increase in {alpha}ENaC expression in HKC-8 cells (Figure 4C). Surprisingly, 5{alpha}-dihydrotestosterone concentrations up to 100 nmol/L did not cause a change in {alpha}ENaC expression in HKC-8 cells (Figure 4D). Treatment with the AR antagonist flutamide resulted in an inhibition of the testosterone effect in a dose-dependent fashion compatible with an interaction with the AR. A total of 10 µmol/L flutamide completely abolished the testosterone effect on {alpha}ENaC expression (Figure 5).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Testosterone stimulates {alpha}ENaC expression. Time course of the fold change in {alpha}ENaC mRNA expression between control HKC 8 cells and testosterone treated HKC-8 cells (500 nmol/L testosterone used; A) and differing testosterone concentrations for 48 hours (B). Dexamethasone (C) but not 5{alpha}-dihydrotestosterone (D) increased {alpha}ENaC mRNA in HKC-8 cells. Zero hours and 0 nmol/L were set as 1. Statistical calculations are comparing different time points/concentrations with start at 0 hour or 0 nmol/L. For each time point/concentration, 3 flasks of control cells and 3 flasks of treated cells were grown. cDNA from each flask was assessed at least in duplicate using singleplex quantitative TaqMan real-time PCR with 18S as housekeeping gene. All incubations were repeated 3 times. *P<0.05; **P<0.01; ***P<0.001.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Testosterone stimulates {alpha}ENaC expression via the AR: fold change in {alpha}ENaC mRNA expression between control HKC-8 cells and testosterone (50 nmol/L)-treated HKC-8 cells in the presence of increasing concentrations of the AR antagonist flutamide for 48 hours. Controls with no testosterone and no flutamide were set as 1. For each concentration, 3 flasks of cells were grown. cDNA from each flask was assessed at least in duplicate using singleplex quantitative TaqMan real-time PCR with 18S as housekeeping gene. All incubations were repeated 3 times. ***P<0.001 compared with controls; §§§P<0.001 compared with treatment with 50 nmol/L testosterone.

We then investigated the regulation of sgk1 in HKC-8 cells after treatment with testosterone, 5{alpha}-dihydrotestosterone, or dexamethasone. There was no effect of testosterone or 5{alpha}-dihydrotestosterone on sgk1 mRNA expression, but dexamethasone significantly induced sgk1 mRNA expression (mean dCT±SD 8.2±0.8 control to 6.8±0.8 100 nmol/L dexamethasone; P<0.05).

{alpha}ENaC Promoter Region
On analyzing the sequence of the {alpha}ENaC promoter, we found a nuclear factor {kappa}B binding side, AP-1 and AP-4 sides, octamer transcription factor-1 (Oct-1), E12, several Sp1 motifs, and a retinoid X receptor-{alpha}/retinoic acid receptor-{alpha}1 binding side within the exon 1A sequence.20 Upstream of the transcription start site of exon 1A, several Sp1 sites, AP-1, AP-2{alpha}, and AP-4 sites, GATA-1 and NF-1 sites, as well as 2 CCAAT/enhancer-binding protein {alpha} and 1 Oct-1 sites were found. At nucleotide position 155-140 upstream of the exon 1A transcription start site, an ARE was found (AGAACAGAATGTCCT). This demonstrates >90% identity with the reported glucocorticoid receptor hormone response element (GRE).21

Effects of Testosterone and Other Steroids on {alpha}ENaC Promoter–Reporter Constructs
Transient transfection of HKC-8 cells was performed using either an empty pGL3 vector or the pGL3 vector with construct 1 (no ARE sequence), 2, 3, or 4 (all containing the ARE) into HKC-8 cells (Figure 6A). The empty pGL3 vector and construct 1 were not influenced by increasing testosterone concentrations (Figure 6B). However, with increasing testosterone concentrations, luciferase activity of construct 2, containing the putative ARE, showed a dose dependency and reached a >3-fold increase (Figure 6B). Constructs 3 and 4 (containing the ARE) showed a 2-fold increase in luciferase activity by testosterone treatment (Figure 6B). At 100 nmol/L testosterone, construct 2 had a significantly higher luciferase signal (P<0.005) than constructs 3 and 4 (Figure 6B). Construct 2 showed a small but not significant induction in luciferase activity by 100 nmol/L 5{alpha}-dihydrotestestosterone (Figure 6C), which was much smaller than the induction of construct 2 by testosterone. The induction of luciferase activity by 100 nmol/L testosterone of construct 2 could be blocked by treatment with the AR antagonist flutamide, whereas construct 1 (no ARE sequence) showed no induction by testosterone or flutamide treatment (Figure 7A). In addition, mutation of the putative ARE abolished the induction by testosterone (Figure 7B).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Direct effects of testosterone on {alpha}ENaC gene promoter activity. A, Constructs of 5'-flanking region of the human {alpha}ENaC and its primers used in transfections to determine the region necessary for transcriptional response. The bent arrow indicates the transcription initiation site for {alpha}ENaC-1 (exon 1A). B, Constructs were transiently transfected into HKC-8 cells in the presence or absence of testosterone (0 to 100 nmol/L; 48-hour incubation). Luciferase (Luc) activity levels (normalized by cotransfection with a renilla luciferase construct) were reported as fold increase compared with the corresponding construct with 0 nmol/L testosterone, which was set as 1. Means of quadruplicate incubations and duplicate measurements±SD. *P<0.05; **P<0.01; ***P<0.001. C, Constructs 1 and 2 were transiently transfected into HKC-8 cells and treated with 100 nmol/L testosterone (T) or 100 nmol/L 5{alpha}-dihydrotestosterone (DHT). Luciferase activity levels (normalized by cotransfection with a renilla luciferase construct) were reported as fold increase compared with the corresponding construct (ctr) without steroid, which was set as 1. Means of quadruplicate incubations and duplicate measurements±SD. ***P<0.001 to ctr.

In an additional experiment, we compared the effect of physiological concentrations of aldosterone, cortisol, and testosterone on {alpha}ENaC promoter–reporter constructs. Physiological testosterone concentrations (10 nmol/L) showed a similar fold induction of construct 2 (containing the ARE) as 0.5 nmol/L aldosterone (Figure 8). Physiological concentrations of cortisol (100 nmol/L) showed a significantly higher fold induction of construct 4 (Figure 8).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 8. Comparison of physiological aldosterone, cortisol, and testosterone concentrations on {alpha}ENaC gene promoter activity. Constructs were transiently transfected into HKC-8 cells in the presence or absence of 0.5 nmol/L aldosterone (A), 100 nmol/L cortisol (F), or 10 nmol/L testosterone (T; 48-hour incubation). Luciferase activity levels (normalized by cotransfection with a renilla luciferase construct) were reported as fold increase compared with the corresponding construct (ctr) without steroid, which was set as 1. Means of quadruplicate incubations and duplicate measurements±SD. ***Significant (P<0.001) to ctr.

Animal Experiments
Testosterone treatment in rats resulted in significantly increased {alpha}ENaC mRNA expression in the kidney (Figure 9). This was found for both testosterone concentrations tested. Treatment with the more potent androgen 5{alpha}-dihydrotestosterone also resulted in an increase of {alpha}ENaC mRNA expression in the kidney, but this effect was less pronounced than for testosterone (Figure 9).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 9. Fold increase in kidney {alpha}ENaC mRNA expression in orchiectomized rats with testosterone or 5{alpha}-dihydrotestosterone treatment for 14 days compared with controls. Each group consisted of 4 animals. Each kidney was investigated at least in triplicate. Controls were set as 1. Means±SD. *P<0.05 and ***P<0.001 compared with control.

Electrophysiological Transepithelial Measurements
The Rte of the M-1 cells ranged from 50 to 200 Ohm · cm2. The Ieq measured in these studies is clearly mediated predominantly by epithelial Na+ channels (ENaCs). Addition of 10 µmol/L amiloride, an inhibitor of ENaC, to the apical compartment rapidly decreased Ieq. The vehicle control group (ethanol) showed a significantly lower response to amiloride than M-1 cells treated with testosterone (Figure 10).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 10. Ieq (in µA/cm2) in response to addition of 10 µmol/L amiloride to the apical compartment in untreated (control) and testosterone-treated M-1 mouse cortical collecting duct cells. A, Time course. B, Change of Ieq attributable to amiloride; means±SEM (n=7).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Gender differences in the kidney were investigated in previous studies using cultured mesangial cells showing that estradiol had a modest proliferative effect and increased matrix metalloproteinase activity, whereas testosterone was not effective. This was regarded as "protective" effect of female gender on the progression of renal disease.22–24 Recently, it was shown that physiological testosterone levels induced an increase in apoptosis in human tubule cell line (HK-2) cells and human primary cultures of proximal tubular epithelial cells.25 However, this is the first report of the effects of testosterone on epithelial sodium transport in a human-derived renal cell line.

The human renal cell line HKC-8 expressed typical features of distal tubular cells such as 11ß-HSD2, MR, and sgk1 and was chosen as a human-derived model to analyze the effects of androgens on genes associated with sodium homeostasis. It is necessary to emphasize that the HKC-8 cells are a transformed cell line, and therefore, the data obtained should be interpreted with caution.

Interestingly, HKC-8 cells converted androstenedione to 5{alpha}-androstanedione because of a high 5{alpha}-reductase 1 expression (Figure 2), which is a similar finding to cultured rat inner medullary collecting duct cells.26 Testosterone was neither activated to 5{alpha}-dihydrotestosterone nor inactivated to androstenedione and was not converted to estradiol, and therefore, we used testosterone for our experiments. The AR was strongly expressed in HKC-8 cells but also in human kidney samples (Figure 1). Kidney from 3 male patients showed AR protein expression, whereas 1 sample from a female patient showed no AR expression. Immunocytochemical studies have located the AR to the distal tubules of the human kidney,27,28 which also expresses the amiloride-sensitive ENaC.

Modulation of epithelial sodium reabsorption in the kidney through the expression and activity of the ENaC is an important component in the control of sodium balance and blood pressure. This channel is composed of 3 subunits with similar structures: {alpha}, ß, and {gamma}.29,30 The {alpha}-subunit supports sodium conductance when expressed alone; the ß- and {gamma}-subunits do not, but they do cause augmentation of channel activity when expressed with the {alpha}-subunit.31 The importance of this channel is clearly demonstrated by rare genetic disorders such as Liddle’s syndrome32 and pseudohypoaldosteronism type 1.33 Recently, it was suggested that genetic variations (A(2139)G polymorphism) in the sodium channel nonvoltage-gated 1 {alpha} gene encoding for {alpha}ENaC could lead to an increased risk of hypertension.34 The 3 subunits of ENaC appear to be differentially regulated in specific tissues. In kidney, aldosterone causes an increase in {alpha}ENaC mRNA expression but does not alter mRNA expression of the other 2 subunits, whereas in colon, aldosterone mainly induces ß- and {gamma}-subunit expression.35–39 Glucocorticoids induce {alpha}ENaC mRNA expression in lung, kidney, and colon but ß- and {gamma}-subunit mRNA expression only in lung and colon and not in kidney.39–41 We identified a similar40 expression pattern of ENaC subunits under basal conditions in the human renal cell line HKC-8: {alpha}ENaC was abundantly expressed, whereas ßENaC and {gamma}ENaC were not detectable. Testosterone upregulated only mRNA expression for {alpha}ENaC (Table 2; Figure 4A and 4B), an effect that was mediated by the AR in that it was antagonized completely by the AR antagonist flutamide (Figure 5). Serum testosterone levels in healthy men range between 13 and 30 nmol/L and 0.5 to 2 nmol/L in healthy women. Testosterone may also be formed through intrarenal synthesis as reported previously.19 Extrapolating from our dose-response studies (Figure 4B), physiological testosterone concentrations and possible intrarenal androgen synthesis19 may be high enough to cause a 2- to 3-fold increase in {alpha}ENaC mRNA expression in men. Changes in sodium transport by increasing {alpha}ENaC expression without affecting ß- and {gamma}-subunit expression may be subtle (2- to 3-fold), as shown by Sayegh et al42 and in this study, but it is an interesting finding and a possible explanation for the differences in blood pressure in normal subjects occurring with the onset of puberty.

We performed electrophysiological experiments and showed that testosterone treatment of M-1 cells resulted in a significantly larger response to amiloride than control cells. This indicates that testosterone enhances the amiloride-sensitive sodium transport across the renal epithelia (Figure 10). The relative incongruity between the large upregulatory effect of testosterone on {alpha}ENaC message in HKC-8 cells and the small functional response obtained in M-1 cells may be attributable to species (human versus mouse) and/or compartmental differences (proximal versus distal origin of the cell lines). In our studies, we used defined media without FCS to avoid nonspecific effects that may be induced by serum or other undefined factors. Although the difference between testosterone treatment and control was relatively small, this difference was consistent and significant. However, we were able to demonstrate that this effect of testosterone is not only an in vitro phenomenon in renal cell lines, but that this effect is also present in an in vivo rat model (Figure 9). In vivo testosterone treatment of rats resulted in a significant increase in {alpha}ENaC expression in the rat kidney.

Surprisingly, 5{alpha}-dihydrotestosterone did not change {alpha}ENaC mRNA expression in HKC-8 cells, although a small but not significant induction of {alpha}ENaC promoter construct 2 by 5{alpha}-dihydrotestosterone was observed (Figure 6C). According to the in vitro data, we found a significant lower increase in renal {alpha}ENaC mRNA expression with the more potent androgen 5{alpha}-dihydrotestosterone in our in vivo rat model (Figure 9). Recent evidence suggests that different AREs could respond differentially to testosterone versus 5{alpha}-dihydrotestosterone, indicating that target gene DNA sequences may be important factors regulating testosterone versus 5{alpha}-dihydrotestosterone differential transactivation.43 In addition, it is possible that the testosterone–AR-ARE complex recruits different AR coregulators compared with 5{alpha}-dihydrotestosterone–AR-ARE complex.44,45 Another possible explanation for this finding may be the expression of 17ß-HSD2 and 17ß-HSD4 (Figure 2), inactivating 5{alpha}-dihydrotestosterone to 5{alpha}-androstanedione at a "prereceptor" level in HKC-8 cells.

Dexamethasone increased {alpha}ENaC mRNA expression in HKC-8 cells, which is in agreement with studies by others using human lung cell lines.40,42,46 This has been explained by a GRE in the 5'-flanking region of the gene encoding {alpha}ENaC (SCNN1A).42,47 This response element is in fact an ARE with 93% similarity to GRE, which may explain transcriptional regulation of {alpha}ENaC by testosterone, glucocorticoids, and mineralocorticoids.48 It is located 155-140 nucleotides upstream of the transcription start side of exon 1A in the SCNN1A gene and seems to regulate transcription start sites of exon 1A and 1B.42 We located putative transcription factor binding sides of Oct-1 and NF-1 proximal of the AR binding side, which may potentiate the relative responsiveness of the AR-regulated promoter.49 Our promoter–reporter studies indicated that this ARE is required for the direct transcriptional upregulation of {alpha}ENaC mRNA by testosterone. Promoter construct 2 containing the ARE showed a significantly higher luciferase activity than construct 1, which does not contain the ARE sequence (Figure 6B), and this testosterone-dependent increase of construct 2 was blocked by flutamide (Figure 7A). In addition, testosterone-mediated transcription was abolished by mutation of the ARE in construct 2 (Figure 7B). Without testosterone, construct 2 showed a 2-fold higher luciferase activity than construct 1 (data not shown), which may be attributable to several Sp1 consensus sites in the construct 2 sequence. The activity of TATA-less promoters, such as the human {alpha}ENaC promoter, is frequently dependent on Sp1 sites in the proximal promoter region. Interestingly, construct 3, which is 200-bp longer at the 5'-end than construct 2, and construct 4, which spans >1.5 kb, also showed a significant increase in luciferase activity by testosterone, but not as high as construct 2 at high testosterone concentrations. This suggests the existence of possible repressor sites in this region: 1 AP-2{alpha}, 2 NF-1, 2 Sp1, and 1 polyomavirus enhancer activator 3 (PEA3) consensus sites were found in this region of the promoter. In corneal epithelial cells, AP-2 functions as a repressor of K3 keratin expression, opposing the effects of Sp1.50 Competition has been proposed between NF-1 proteins and Sp1 for binding at adjacent sites as a means for NF-1 to repress Sp1 activation of the promoter.51 PEA3 belongs to the PEA/external transcribed spacer family, which is able to interact directly with the AR and modulate androgen-dependent gene expression.52 Physiological testosterone concentrations (10 nmol/L) had the same effect as physiological aldosterone concentrations (0.5 nmol/L) on the promoter activity (Figure 8), and 100 nmol/L cortisol showed a significantly higher increase of luciferase activity for construct 4 (Figure 8). Because of the artificial system, it is difficult to draw conclusions for clinical or pathophysiological situations from these differences for these hormones.

In addition to direct transcriptional regulation, there are several additional mechanisms that may alter ENaC activity (eg, post-translational modification by sgk1). Sgk1 is a mineralocorticoid-inducible gene and regulates ENaC distribution at the luminal side of the epithelial cell through phosphorylation of Nedd4-2. Phosphorylated Nedd4-2 is not able to mediate ubiquination and degradation of ENaC from the cell surface.53 We found an increase in sgk1 mRNA expression with dexamethasone but not after incubation with androgens in HKC-8 cells (Table 2).

In conclusion, we described the direct upregulation of {alpha}ENaC mRNA expression by testosterone via the AR in vitro in the human renal cell line HKC-8 and in vivo in a rat model.

Perspectives
In men, androgens either from circulation or from intrarenal synthesis can bind to the AR in distal tubular cells and may increase {alpha}ENaC mRNA expression and epithelial sodium transport. This mechanism provides a possible explanation for the higher normal blood pressure observed in men compared with women. Future studies should explore whether this may be also an important target for management of the increased susceptibility to hypertension in men.


*    Acknowledgments
 
This work was supported by a Deutsche Forschungsgemeinschaft postdoctoral research fellowship grant (QU142/1-1) to M.Q. and the Medical Research Council (cooperative core group grant). This work received the Schoeller-Junkmann Award 2005 of the German Endocrine Society. We would like to thank David M. Smith, Carl Montague, and Kay Garnett (AstraZeneca, UK) for help with microarray analysis. Thanks to Kevin Eardley, Department of Nephrology, Queen Elizabeth Hospital, Birmingham, UK, for the primary kidney cell lines, and to Beverly Hughes for T47D cells. We also thank Wiebke Arlt, Nicole Draper, and Elizabeth A. Walker, all of Birmingham, UK, for help with the promoter analysis and transfection studies.

Received March 22, 2005; first decision April 13, 2005; accepted August 19, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Reckelhoff JF. Gender differences in the regulation of blood pressure. Hypertension. 2001; 37: 1199–1208.[Abstract/Free Full Text]

2. Reckelhoff JF, Zhang H, Granger JP. Testosterone exacerbates hypertension and reduces pressure-natriuresis in male spontaneously hypertensive rats. Hypertension. 1998; 31: 435–439.[Abstract/Free Full Text]

3. Reckelhoff JF, Granger JP. Role of androgens in mediating hypertension and renal injury. Clin Exp Pharmacol Physiol. 1999; 26: 127–131.[CrossRef][Medline] [Order article via Infotrieve]

4. Reckelhoff JF, Zhang H, Srivastava K, Granger JP. Gender differences in hypertension in spontaneously hypertensive rats: role of androgens and androgen receptor. Hypertension. 1999; 34: 920–923.[Abstract/Free Full Text]

5. Harshfield GA, Alpert BS, Pulliam DA, Somes GW, Wilson DK. Ambulatory blood pressure recordings in children and adolescents. Pediatrics. 1994; 94: 180–184.[Abstract/Free Full Text]

6. Bachmann H, Horacek U, Leowsky M, Hirche H. [Blood pressure in children and adolescents aged 4 to 18. Correlation of blood pressure values with age, sex, body height, body weight and skinfold thickness (Essen Blood Pressure Study)]. Monatsschr Kinderheilkd. 1987; 135: 128–134.[Medline] [Order article via Infotrieve]

7. Burt VL, Whelton P, Roccella EJ, Brown C, Cutler JA, Higgins M, Horan MJ, Labarthe D. Prevalence of hypertension in the US adult population. Results from the Third National Health and Nutrition Examination Survey, 1988–1991. Hypertension. 1995; 25: 305–313.[Abstract/Free Full Text]

8. Stamler R, Stamler J, Riedlinger WF, Algera G, Roberts RH. Weight and blood pressure. Findings in hypertension screening of 1 million Americans. J Am Med Assoc. 1978; 240: 1607–1610.[Abstract/Free Full Text]

9. Kannel WB, Gordon T, Schwartz MJ. Systolic versus diastolic blood pressure and risk of coronary heart disease. The Framingham study. Am J Cardiol. 1971; 27: 335–346.[CrossRef][Medline] [Order article via Infotrieve]

10. Kannel WB, Wolf PA, Verter J, McNamara PM. Epidemiologic assessment of the role of blood pressure in stroke: the Framingham Study. 1970. J Am Med Assoc. 1996; 276: 1269–1278.[Abstract/Free Full Text]

11. Dubey RK, Oparil S, Imthurn B, Jackson EK. Sex hormones and hypertension. Cardiovasc Res. 2002; 53: 688–708.[Abstract/Free Full Text]

12. Mendelsohn ME, Karas RH. The protective effects of estrogen on the cardiovascular system. N Engl J Med. 1999; 340: 1801–1811.[Free Full Text]

13. Guyton AC, Coleman TG, Cowley AV Jr, Scheel KW, Manning RD Jr, Norman RA Jr. Arterial pressure regulation. Overriding dominance of the kidneys in long-term regulation and in hypertension. Am J Med. 1972; 52: 584–594.[CrossRef][Medline] [Order article via Infotrieve]

14. Racusen LC, Monteil C, Sgrignoli A, Lucskay M, Marouillat S, Rhim JG, Morin JP. Cell lines with extended in vitro growth potential from human renal proximal tubule: characterization, response to inducers, and comparison with established cell lines. J Lab Clin Med. 1997; 129: 318–329.[CrossRef][Medline] [Order article via Infotrieve]

15. van Kooten C, Lam S, Daha MR. Isolation, culture, characterization and use of human renal tubular epithelial cells. J Nephrol. 2001; 14: 204–210.[Medline] [Order article via Infotrieve]

16. Quinkler M, Sinha B, Tomlinson JW, Bujalska IJ, Smith DM, Stewart PM, Arlt W. Androgen generation in adipose tissue from women with simple obesity: a site-specific role for 17-hydroxysteroid dehydrogenase type 5. J Endocrinol. 2004; 183: 331–342.[Abstract/Free Full Text]

17. Callies F, Stromer H, Schwinger RH, Bolck B, Hu K, Frantz S, Leupold A, Beer S, Allolio B, Bonz AW. Administration of testosterone is associated with a reduced susceptibility to myocardial ischemia. Endocrinology. 2003; 144: 4478–4483.[Abstract/Free Full Text]

18. Nahrendorf M, Frantz S, Hu K, von zur Mühlen C, Tomaszewski M, Scheuermann H, Kaiser R, Jazbutyte V, Beer S, Bauer W, Neubauer S, Ertl G, Allolio B, Callies F. Effect of testosterone on post-myocardial infarction remodeling and function. Cardiovasc Res. 2003; 57: 370–378.[Abstract/Free Full Text]

19. Quinkler M, Bumke-Vogt C, Meyer B, Bahr V, Oelkers W, Diederich S. The human kidney is a progesterone-metabolizing and androgen-producing organ. J Clin Endocrinol Metab. 2003; 88: 2803–2809.[Abstract/Free Full Text]

20. Thomas CP, Auerbach S, Stokes JB, Volk KA. 5' heterogeneity in epithelial sodium channel alpha-subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol. 1998; 274: C1312–C1323.[Medline] [Order article via Infotrieve]

21. Beato M. Gene regulation by steroid hormones. Cell. 1989; 56: 335–344.[CrossRef][Medline] [Order article via Infotrieve]

22. Kwan G, Neugarten J, Sherman M, Ding Q, Fotadar U, Lei J, Silbiger S. Effects of sex hormones on mesangial cell proliferation and collagen synthesis. Kidney Int. 1996; 50: 1173–1179.[Medline] [Order article via Infotrieve]

23. Guccione M, Silbiger S, Lei J, Neugarten J. Estradiol upregulates mesangial cell MMP-2 activity via the transcription factor AP-2. Am J Physiol Renal Physiol. 2002; 282: F164–F169.[Abstract/Free Full Text]

24. Potier M, Elliot SJ, Tack I, Lenz O, Striker GE, Striker LJ, Karl M. Expression and regulation of estrogen receptors in mesangial cells: influence on matrix metalloproteinase-9. J Am Soc Nephrol. 2001; 12: 241–251.[Abstract/Free Full Text]

25. Verzola D, Gandolfo MT, Salvatore F, Villaggio B, Gianiorio F, Traverso P, Deferrari G, Garibotto G. Testosterone promotes apoptotic damage in human renal tubular cells. Kidney Int. 2004; 65: 1252–1261.[CrossRef][Medline] [Order article via Infotrieve]

26. Matsuzaki K, Arai T, Inumaru T, Mihori M, Momose T, Sano M, Koide K, Shimizu N. Androgen metabolism in cultured rat renal inner medullary collecting duct (IMCD) cells. Steroids. 1998; 63: 105–110.[CrossRef][Medline] [Order article via Infotrieve]

27. Kimura N, Mizokami A, Oonuma T, Sasano H, Nagura H. Immunocytochemical localization of androgen receptor with polyclonal antibody in paraffin-embedded human tissues. J Histochem Cytochem. 1993; 41: 671–678.[Abstract]

28. Pelletier G, El-Alfy M. Immunocytochemical localization of estrogen receptors alpha and beta in the human reproductive organs. J Clin Endocrinol Metab. 2000; 85: 4835–4840.[Abstract/Free Full Text]

29. Canessa CM, Schild L, Buell G, Thorens B, Gautschi I, Horisberger JD, Rossier BC. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature. 1994; 367: 463–467.[CrossRef][Medline] [Order article via Infotrieve]

30. Snyder PM. The epithelial Na+ channel: cell surface insertion and retrieval in Na+ homeostasis and hypertension. Endocr Rev. 2002; 23: 258–275.[Abstract/Free Full Text]

31. McDonald FJ, Price MP, Snyder PM, Welsh MJ. Cloning and expression of the beta- and gamma-subunits of the human epithelial sodium channel. Am J Physiol. 1995; 268: C1157–C1163.[Medline] [Order article via Infotrieve]

32. Shimkets RA, Warnock DG, Bositis CM, Nelson-Williams C, Hansson JH, Schambelan M, Gill JR Jr, Ulick S, Milora RV, Findling JW. Liddle’s syndrome: heritable human hypertension caused by mutations in the beta subunit of the epithelial sodium channel. Cell. 1994; 79: 407–414.[CrossRef][Medline] [Order article via Infotrieve]

33. Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, Lifton RP. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalemic acidosis, pseudohypoaldosteronism type 1. Nat Genet. 1996; 12: 248–253.[CrossRef][Medline] [Order article via Infotrieve]

34. Iwai N, Baba S, Mannami T, Ogihara T, Ogata J. Association of a sodium channel alpha subunit promoter variant with blood pressure. J Am Soc Nephrol. 2002; 13: 80–85.[Abstract/Free Full Text]

35. Renard S, Voilley N, Bassilana F, Lazdunski M, Barbry P. Localization and regulation by steroids of the alpha, beta and gamma subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney. Pflugers Arch. 1995; 430: 299–307.[CrossRef][Medline] [Order article via Infotrieve]

36. Escoubet B, Coureau C, Bonvalet JP, Farman N. Noncoordinate regulation of epithelial Na channel and Na pump subunit mRNAs in kidney and colon by aldosterone. Am J Physiol. 1997; 272: C1482–C1491.[Medline] [Order article via Infotrieve]

37. MacDonald P, MacKenzie S, Ramage L, Seckl J, Brown RW. Corticosteroid regulation of amiloride-sensitive sodium-channel subunit mRNA expression in mouse kidney. J Endocrinol. 2000; 165: 25–37.[Abstract]

38. Lingueglia E, Renard S, Waldmann R, Voilley N, Champigny G, Plass H, Lazdunski M, Barbry P. Different homologous subunits of the amiloride-sensitive Na+ channel are differently regulated by aldosterone. J Biol Chem. 1994; 269: 13736–13739.[Abstract/Free Full Text]

39. Fuller PJ, Brennan FE, Burgess JS. Acute differential regulation by corticosteroids of epithelial sodium channel subunit and Nedd4 mRNA levels in the distal colon. Pflugers Arch. 2000; 441: 94–101.[CrossRef][Medline] [Order article via Infotrieve]

40. Itani OA, Auerbach SD, Husted RF, Volk KA, Ageloff S, Knepper MA, Stokes JB, Thomas CP. Glucocorticoid-stimulated lung epithelial Na(+) transport is associated with regulated ENaC and sgk1 expression. Am J Physiol Lung Cell Mol Physiol. 2002; 282: L631–L641.[Abstract/Free Full Text]

41. Tchepichev S, Ueda J, Canessa C, Rossier BC, O’Brodovich H. Lung epithelial Na channel subunits are differentially regulated during development and by steroids. Am J Physiol. 1995; 269: C805–C812.[Medline] [Order article via Infotrieve]

42. Sayegh R, Auerbach SD, Li X, Loftus RW, Husted RF, Stokes JB, Thomas CP. Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5'-flanking region of the human epithelial sodium channel alpha subunit gene. J Biol Chem. 1999; 274: 12431–12437.[Abstract/Free Full Text]

43. Hsiao PW, Thin TH, Lin DL, Chang C. Differential regulation of testosterone vs. 5alpha-dihydrotestosterone by selective androgen response elements. Mol Cell Biochem. 2000; 206: 169–175.[CrossRef][Medline] [Order article via Infotrieve]

44. Miyamoto H, Yeh S, Wilding G, Chang C. Promotion of agonist activity of antiandrogens by the androgen receptor coactivator, ARA70, in human prostate cancer DU145 cells. Proc Natl Acad Sci U S A. 1998; 95: 7379–7384.[Abstract/Free Full Text]

45. Riegman PH, Vlietstra RJ, van der Korput JA, Brinkmann AO, Trapman J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol. 1991; 5: 1921–1930.[Abstract/Free Full Text]

46. Chow YH, Wang Y, Plumb J, O’Brodovich H, Hu J. Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel alpha subunit gene. Pediatr Res. 1999; 46: 208–214.[Medline] [Order article via Infotrieve]

47. Mick VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, Thomas CP. The alpha-subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5'-flanking region of the gene. Mol Endocrinol. 2001; 15: 575–588.[Abstract/Free Full Text]

48. Nelson CC, Hendy SC, Shukin RJ, Cheng H, Bruchovsky N, Koop BF, Rennie PS. Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: Evidence for differential steroid receptor response elements. Mol Endocrinol. 1999; 13: 2090–2107.[Abstract/Free Full Text]

49. Adler AJ, Scheller A, Robins DM. The stringency and magnitude of androgen-specific gene activation are combinatorial functions of receptor and nonreceptor binding site sequences. Mol Cell Biol. 1993; 13: 6326–6335.[Abstract/Free Full Text]

50. Chen TT, Wu RL, Castro-Munozledo F, Sun TT. Regulation of K3 keratin gene transcription by Sp1 and AP-2 in differentiating rabbit corneal epithelial cells. Mol Cell Biol. 1997; 17: 3056–3064.[Abstract]

51. Gronostajski RM. Roles of the NFI/CTF gene family in transcription and development. Gene. 2000; 249: 31–45.[CrossRef][Medline] [Order article via Infotrieve]

52. Schneikert J, Peterziel H, Defossez PA, Klocker H, Launoit Y, Cato AC. Androgen receptor-Ets protein interaction is a novel mechanism for steroid hormone-mediated down-modulation of matrix metalloproteinase expression. J Biol Chem. 1996; 271: 23907–23913.[Abstract/Free Full Text]

53. Snyder PM, Olson DR, Thomas BC. SGK modulates Nedd4–2-mediated inhibition of ENaC. J Biol Chem. 2001; 277: 5–8.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
S. Harmsen, A. S. Koster, J. H. Beijnen, J. H. M. Schellens, and I. Meijerman
Comparison of Two Immortalized Human Cell Lines to Study Nuclear Receptor-Mediated CYP3A4 Induction
Drug Metab. Dispos., June 1, 2008; 36(6): 1166 - 1171.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
L. L. Yanes, J. C. Sartori-Valinotti, and J. F. Reckelhoff
Sex Steroids and Renal Disease: Lessons From Animal Studies
Hypertension, April 1, 2008; 51(4): 976 - 981.
[Full Text] [PDF]


Home page
J EndocrinolHome page
A. J Lopez-Contreras, J. D Galindo, C. Lopez-Garcia, M. T Castells, A. Cremades, and R. Penafiel
Opposite sexual dimorphism of 3,4-dihydroxyphenylalanine decarboxylase in the kidney and small intestine of mice
J. Endocrinol., March 1, 2008; 196(3): 615 - 624.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Tomaszewski, F. J. Charchar, M. D. Lynch, S. Padmanabhan, W. Y.S. Wang, W. H. Miller, W. Grzeszczak, C. Maric, E. Zukowska-Szczechowska, and A. F. Dominiczak
Fibroblast Growth Factor 1 Gene and Hypertension: From the Quantitative Trait Locus to Positional Analysis
Circulation, October 23, 2007; 116(17): 1915 - 1924.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Franceschini, J. W. MacCluer, H. H.H. Goring, S. A. Cole, K. M. Rose, L. Almasy, V. Diego, S. Laston, E. T. Lee, B. V. Howard, et al.
A Quantitative Trait Loci-Specific Gene-by-Sex Interaction on Systolic Blood Pressure Among American Indians: The Strong Heart Family Study
Hypertension, August 1, 2006; 48(2): 266 - 270.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/4/787    most recent
01.HYP.0000184362.61744.c1v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Related Collections
Right arrow ACE/Angiotension receptors
Right arrow Other hypertension
Right arrow Ion channels/membrane transport