| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2005;46:1180.)
© 2005 American Heart Association, Inc.
Original Articles |
From the Departments of Cardiovascular Medicine (N.I., K.S., G.M., M.S., M.O., N.R.), and Diabetes and Metabolic Disease (M.H.), University of Tokyo Graduate School of Medicine, Japan; and Department of Pathology (I.M.), Wakayama Medical College, Japan.
Reprint requests to Nobukazu Ishizaka, MD, PhD, Department of Cardiovascular Medicine, University of Tokyo, Graduate School of Medicine, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-8655, Japan. E-mail nobuishizka-tky{at}umin.ac.jp
| Abstract |
|---|
|
|
|---|
Key Words: angiotensin II transforming growth factors lipids
| Introduction |
|---|
|
|
|---|
We found that long-term administration of angiotensin II (Ang II) to rats caused marked deposition of iron10 and upregulation of the expression of transforming growth factor-ß1 (TGF-ß1) in renal tubular epithelial cells.11 We also found that iron chelation attenuated the Ang IIinduced upregulation of TGF-ß1 in the kidney, suggesting a possible link between aberrant iron homeostasis and TGF-ß1 upregulation. However, unexpectedly, histological analysis showed that upregulation of TGF-ß1 mRNA and deposition of iron occurred in different tubular cells in most cases. The aims of the present study were to investigate whether accumulation of lipids occurs in the kidney of Ang IIinfused animals and to investigate the relationship between lipid accumulation and TGF-ß1 in terms of localization. We also investigated whether Ang II infusion alter the expression of genes that have relation to the lipid metabolism, such as ATP-binding cassette transporter subfamily A-1 (ABCA1), scavenger receptor class B type 1 (SR-B1), sterol regulatory element-binding protein 1 (SREBP-1), SREBP-2, 3-hydroxy-3-methylglutarylcoenzyme A (HMG-CoA) reductase, acetyl-CoA carboxylase (ACC), stearoyl-CoA desaturase-1 (SCD-1), CoA:diacylglycerol acyltransferase-1 (DGAT-1), and LDL receptor. Furthermore, we investigated whether iron chelation affects the degree of lipid accumulation in the kidney of Ang IIinfused animals.
| Materials and Methods |
|---|
|
|
|---|
Measurement of Lipid Contents in the Serum and Renal Cortex
Serum levels of total cholesterol (TC) and TGs in each sample were measured by enzymatic methods (SRL) using Total Cholesterol E Test Wako and Triglycerides E Test Wako (Wako Pure Chemicals), respectively.
Western Blot Analysis, Immunohistochemistry, and In Situ Hybridization
Western blot analysis was performed as described previously.13 Polyclonal antibodies against ABCA1 (Novus Biologicals), SR-B1 (Novus Biologicals), SREBP-1 (Santa Cruz Biotechnology), and SREBP-2 (Santa Cruz Biotechnology) were used at dilutions of 1/1000, 1/1000, and 1/500, respectively. Immunohistochemistry was performed as described previously.13 For this purpose antiSREBP-1 antibody was used at a dilution of 1/200. In situ hybridization was performed as described previously.11
Oxidative Fluorescent Microscopy
Staining with the oxidative fluorescent dye dihydroethidium (DHE) was performed as described previously.11 Fluorescence intensity was obtained for
6 fields for each section. The fluorescent intensity in Ang IItreated group was presented as the percentage of that of untreated control group.
Real-Time RT-PCR
Real-time quantitative PCR was performed by LightCycler (Roche Diagnostics). Gene expression was normalized to the endogenous control GAPDH mRNA in each sample, and then the amount of target gene expression in the sample from treated animals was expressed as the percentage of that in the untreated control. The following primers and probes were used: for HMG-CoA reductase: forward 5' GACACTTACAATCTGTATGATG 3'; reverse 5' CTTGGAGAGGTAAAACTGCCA 3'; for ACC: forward 5' GAATTTGTCACCCGCTTTGG 3', reverse 5' TGGAGCGCATCCACTTGA 3'; for SCD-1: forward 5' CCTTAACCCTGAGATCCCGTAGA 3', reverse 5' AGCCCATAAAAGATTTCTGCAAA 3'; for DGAT-1, forward: 5' TCTTCCTACCGGGATGTCAATC 3', reverse 5' TCCCTGCAGACACAGCTTTG 3'; for LDL receptor, forward: 5' TCCTCATCCTGCCTAAGT 3, reverse 5' TGTAGTGCTTGTGCTACAGAG 3'; for plasminogen activator inhibitor-1 (PAI-1), forward: 5' TCCTCATCCTGCCTAAGT 3', reverse 5' TGTAGTGCTTGTGCTACAGAG 3'; and for GAPDH: forward 5' TGAACGGGAAGCTCACTGG 3', reverse 5' TCCACCACCCTGTTGCTGTA 3'.
Statistical Analysis
Data are expressed as the mean±SEM. We used ANOVA followed by a multiple comparison test to compare raw data before expressing the results as a percentage of the control value using the statistical analysis software Statistica version 5.1 J for Windows (StatSoft Inc). A value of P<0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
|
|
Lipid Staining
Oil red O staining of kidney sections showed no apparent lipid deposition in the kidneys of untreated rats (Figure 1A). On the other hand, in Ang IIinfused rats, marked accumulation of oil red Ostainable lipid was observed in tubular epithelial cells in kidney sections (Figure 1B). Lipid deposition was not apparent in kidney sections from the norepinephrine-infused rats (Figure 1C). Staining of serial sections showed that lipid deposits that were positively stained by oil red O (Figure 1D) could also be stained positively by Sudan black (Figure 1E). In Ang IIinfused rats, the percentage of cells that were positive for iron deposition decreased after the treatment with an iron chelator (Figure 1F).
|
Staining for Superoxide, Lipids, and Iron
We previously found that superoxide production was increased in tubular epithelial cells that contain granular materials in the kidneys of Ang IIinfused rats,11 and that majority of the cells that contained these granular materials were not positive for iron staining.10,11 In the current study, staining of serial sections showed that tubular cells found to contain granular material on differential interference contrast (DIC) images were positive for oil red O staining, indicating that observed granular materials are lipid droplets (Figure 2A and 2B). Cells with granular materials (ie, lipid droplets) had increased superoxide production (Figure 2B through 2G), which is consistent with a previous report.11 The levels of superoxide detected by DHE oxidation were increased after Ang II administration (control 100±10%, n=4 versus Ang II 209±30%, n=4; P<0.01). Only a small fraction of lipid-positive cells were found to be positive for iron deposition (Figure 2H and 2I, asterisks), which is again consistent with previous findings.11
|
In Situ Hybridization for TGF-ß1
The antisense but not sense (Figure 3A) probes for TGF-ß1 mRNA showed positive staining in tubular epithelial cells (Figure 3B and 3D). Cells that expressed increased levels of TGF-ß1 mRNA contained oil red Ostainable lipid deposits (Figure 3C and 3E). Higher magnification revealed that cells with increased levels of TGF-ß1 mRNA contained lucid granular materials, which were presumably lipid droplets (Figure 3F). Lipid deposition was occasionally observed in the vascular wall cells, in which increased TGF-ß1 mRNA expression was observed (Figure 3G and 3H). On the other hand, vascular wall cells that did not contain lipid deposition did not express increased levels of TGF-ß1 mRNA (Figure 3I and 3J).
|
Regulation of Genes Related to Lipid Metabolism and PAI-1
Western blot analysis showed that the expression of SREBP-1 and ABCA1 but not AR-B1 was increased in the kidneys of Ang IItreated animals (Figure 4A and 4B). Administration of norepinephrine did not significantly alter the expression of SREBP-1, and Ang IIinduced upregulation of SREBP-1 was suppressed by iron chelation. (Figure 4C and 4D). Immunohistochemical and histological analysis showed that Ang II increased protein expression of SREBP-1 in the tubular cells, where deposition of oil red Ostainable lipid was positive (Figure 5).
|
|
Expression of HMG-CoA reductase, ACC, SCD-1, DGAT-1, LDL receptor, and fatty acid synthase (FAS) in the control kidney were examined by quantitative RT-PCR. In the kidney of control (n=10) and Ang IIinfused (n=11) animals, expression of these genes were as follows: HMG-CoA reductase 100±7% versus 129±18%, respectively (P=NS); ACC 100±7% versus 84±5%, respectively (P=NS); SCD-1 100±41% versus 99±50%, respectively (P=NS); DGAT-1 100±17% versus 83±8, respectively (P=NS); LDL receptor 100±30% versus 165±20%, respectively (P<0.05); and FAS 100±10% versus 153±25%, respectively (P<0.05). Deferoxamine suppressed Ang IIinduced upregulation of LDL receptor (76±9%; n=5; P=NS versus control) and FAS mRNA (70±19%; n=6; P=NS versus control). Ang II infusion increased PAI-1 mRNA expression in the kidney (control 100±22%; n=11 versus Ang II 191±24%, n=10; P<0.01), which was again suppressed by deferoxamine (137±30%; n=5; P=NS versus control).
| Discussion |
|---|
|
|
|---|
We showed previously that administration of Ang II to rats induces the expression of ferritin and heme oxygenase-1,13 an enzyme for heme degradation, in the renal tubular cells,10 and that tubular epithelial cells with increased expression of these proteins were positive for Prussian bluestainable iron.10 We found that Ang IIinduced aberrant iron homeostasis may have modulatory effects on the extent of urinary protein excretion10 and on the expression of genes that have relation to anti-aging14 and fibrogenesis.11 However, notably, in situ hybridization showed that the localization of upregulation of TGF-ß1 mRNA and deposition of iron were found to occur in different renal tubular cells.11 In addition, cells that contain granular materials observed by DIC were also negative for iron staining.11 In the current study, the granular materials observed in the tubular cells were identified as lipid droplets, and cells with lipid deposition were found to have intense expression of TGF-ß1 mRNA and increased levels of superoxide.
Lipid deposition in the kidney may not be a rare phenomenon in certain animal models1517 and in humans.18 Several investigators advocated that it may play a crucial role in the development of renal damage, which might be, in part, mediated by the peroxydized lipids.17,19,20 Guijarro et al21 reported that dietary-induced hyperlipidemia increased the renal expression of collagen and TGF-ß.22,23 Eddy et al20 showed that diet-induced hypercholesterolemia induced renal lipid deposition and upregulation of TGF-ß expression in the kidney of uninephrectomized rats. To the best of our knowledge, the present study is the first to demonstrate the colocalization of lipid deposits and increased TGF-ß1 mRNA expression in animal models of human diseases.
Several previous studies suggested that Ang II may affect circulating lipid content. Hanefeld et al24 showed that treatment of hypertensive patients with Ang II type 1 (AT1) receptor blocker significantly reduced the plasma TC level. The AT1 receptor blocker was potent in reducing the plasma TG level,25 and conversely, Ang II infusion increased the plasma TG levels by stimulating hepatic TG production in rats.26 In our animal models, the plasma levels of TC and TGs also increased after Ang II infusion. Thus, it is possible that lipid deposition in the kidney occurred in response to the increased level of circulating lipids.
In the present study, we also found that expression of SREBP-1 and FAS was increased in the kidney of Ang IIinfused animals. Previous studies showed the possible link between Ang II and FAS expression in the adipocyte.27 Our data suggested that Ang II may also increase FAS expression in the kidney, which might result in the increased production of lipids. Sun et al28 reported that SREBP-1 expression is upregulated in the kidney of diabetic animals. Interestingly, Sun et al also showed that induction of SREBP-1 caused upregulation of not only FAS but also of TGF-ß1 in the kidney.28 Together with our findings, it is suggested that altered renal expression of lipogenesis-related genes may play a crucial role in the regulation of TGF-ß1 expression. We also found that Ang II infusion increased the renal expression of LDL receptor. Whether this phenomenon is the underlying mechanism of increase in the cortical TC content after Ang II infusion should be investigated in future experiments.
Although underlying mechanisms that link between iron and lipid dysregulation in the kidney remain unknown, there are several possibilities. First, tubular cells in proteinuric states carry large amounts of lipids, and fatty elements may be correlated with the degree of proteinuria.29 Thus, iron chelation may have suppressed renal lipid deposition by decreasing the urinary excretion of protein.10 Second, in the current study, iron chelation reduced the increase in plasma lipid content in Ang IIinfused animals. Because hyperlipidemia may cause lipid accumulation in the renal tubular cells,30 deferoxamine may have suppressed renal lipid accumulation by lowering circulating lipids.31 Third, Zager et al32,33 reported the possible relationship between (heme) iron overload and regulation of lipogenesis-related genes in the kidney.32 We found that expression of Ang IIinduced upregulation of FAS mRNA was inhibited by iron chelation. Thus, aberrant iron homeostasis may directly modulate expression of lipogenesis-related genes in the kidney. However, if so, whether certain paracrine substances would be released from the iron-positive cells that may alter the expression of lipogenesis-related genes should be investigated because iron deposition and lipid accumulation occurred in the different tubular cells.
In the present study, Ang II infusion also induced lipid deposition in the vascular wall cells, in which TGF-ß1 mRNA expression was found to be upregulated. It has been shown that Ang II plays a crucial role in the lipid deposition in the arterial wall, an early event of atherogenic processes,34 and TGF-ß upregulation in the aortas.35,36 We are now examining whether upregulation of TGF-ß1 mRNA in the kidney is a downstream event of lipid deposition and whether lipid deposition also occurs in the aorta in the Ang IIinfused rat.
In conclusion, long-term administration of Ang II caused robust accumulation of lipids in the rat kidney. TGF-ß1 mRNA expression and superoxide production were found to be increased in renal tubular cells and vascular wall cells that contained oil red Ostainable lipids. Iron chelation suppressed the increases in serum lipid levels and in the lipid content of the renal cortical tissues in Ang IIinfused rats. These findings collectively suggest the existence of a relationship among altered lipid metabolism, aberrant iron homeostasis, and the extent of renal injury in the kidneys of Ang IIinfused rats.
| Acknowledgments |
|---|
Received March 28, 2005; first decision April 16, 2005; accepted August 24, 2005.
| References |
|---|
|
|
|---|
2. Unger RH. Lipotoxic diseases. Annu Rev Med. 2002; 53: 319336.[CrossRef][Medline] [Order article via Infotrieve]
3. Barnes SE, Weinberg PD. Two patterns of lipid deposition in the cholesterol-fed rabbit. Arterioscler Thromb Vasc Biol. 1999; 19: 23762386.
4. Nunnari JJ, Fisher M, White SD. Inhibition of lipid deposition in the hypercholesterolemic rat by clentiazem, a calcium channel blocker. Exp Mol Pathol. 1992; 57: 193204.[CrossRef][Medline] [Order article via Infotrieve]
5. Rogers KA, Karnovsky MJ. A rapid method for the detection of early stages of atherosclerotic lesion formation. Am J Pathol. 1988; 133: 451455.[Abstract]
6. Sharma S, Adrogue JV, Golfman L, Uray I, Lemm J, Youker K, Noon GP, Frazier OH, Taegtmeyer H. Intramyocardial lipid accumulation in the failing human heart resembles the lipotoxic rat heart. FASEB J. 2004; 18: 16921700.
7. Zhou YT, Grayburn P, Karim A, Shimabukuro M, Higa M, Baetens D, Orci L, Unger RH. Lipotoxic heart disease in obese rats: implications for human obesity. Proc Natl Acad Sci U S A. 2000; 97: 17841789.
8. Ramesh S, Sanyal AJ. Hepatitis C and nonalcoholic fatty liver disease. Semin Liver Dis. 2004; 24: 399413.[CrossRef][Medline] [Order article via Infotrieve]
9. Moorhead JF, Chan MK, El-Nahas M, Varghese Z. Lipid nephrotoxicity in chronic progressive glomerular and tubulo-interstitial disease. Lancet. 1982; 2: 13091311.[Medline] [Order article via Infotrieve]
10. Ishizaka N, Aizawa T, Yamazaki I, Usui S, Mori I, Kurokawa K, Tang SS, Ingelfinger JR, Ohno M, Nagai R. Abnormal iron deposition in renal cells in the rat with chronic angiotensin II administration. Lab Invest. 2002; 82: 8796.[Medline] [Order article via Infotrieve]
11. Saito K, Ishizaka N, Aizawa T, Sata M, Iso ON, Noiri E, Ohno M, Nagai R. Role of aberrant iron homeostasis in the upregulation of transforming growth factor-beta1 in the kidney of angiotensin II-induced hypertensive rats. Hypertens Res. 2004; 27: 599607.[CrossRef][Medline] [Order article via Infotrieve]
12. Ishizaka N, de Leon H, Laursen JB, Fukui T, Wilcox JN, De Keulenaer G, Griendling KK, Alexander RW. Angiotensin II-induced hypertension increases heme oxygenase-1 expression in rat aorta. Circulation. 1997; 96: 19231929.
13. Aizawa T, Ishizaka N, Taguchi J, Nagai R, Mori I, Tang SS, Ingelfinger JR, Ohno M. Heme oxygenase-1 is upregulated in the kidney of angiotensin II-induced hypertensive rats: possible role in renoprotection. Hypertension. 2000; 35: 800806.
14. Saito K, Ishizaka N, Mitani H, Ohno M, Nagai R. Iron chelation and a free radical scavenger suppress angiotensin II-induced downregulation of klotho, an anti-aging gene, in rat. FEBS Lett. 2003; 551: 5862.[CrossRef][Medline] [Order article via Infotrieve]
15. Fujihara CK, Padilha RM, Zatz R. Glomerular abnormalities in long-term experimental diabetes. Role of hemodynamic and nonhemodynamic factors and effects of antihypertensive therapy. Diabetes. 1992; 41: 286293.[Abstract]
16. Coimbra TM, Janssen U, Grone HJ, Ostendorf T, Kunter U, Schmidt H, Brabant G, Floege J. Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes. Kidney Int. 2000; 57: 167182.[CrossRef][Medline] [Order article via Infotrieve]
17. Chander PN, Gealekman O, Brodsky SV, Elitok S, Tojo A, Crabtree M, Gross SS, Goligorsky MS. Nephropathy in Zucker diabetic fat rat is associated with oxidative and nitrosative stress: prevention by chronic therapy with a peroxynitrite scavenger ebselen. J Am Soc Nephrol. 2004; 15: 23912403.
18. Lee HS, Lee JS, Koh HI, Ko KW. Intraglomerular lipid deposition in routine biopsies. Clin Nephrol. 1991; 36: 6775.[Medline] [Order article via Infotrieve]
19. Dominguez JH, Tang N, Xu W, Evan AP, Siakotos AN, Agarwal R, Walsh J, Deeg M, Pratt JH, March KL, Monnier VM, Weiss MF, Baynes JW, Peterson R. Studies of renal injury III: lipid-induced nephropathy in type II diabetes. Kidney Int. 2000; 57: 92104.[CrossRef][Medline] [Order article via Infotrieve]
20. Eddy AA. Interstitial inflammation and fibrosis in rats with diet-induced hypercholesterolemia. Kidney Int. 1996; 50: 11391149.[Medline] [Order article via Infotrieve]
21. Guijarro C, Kasiske BL, Kim Y, ODonnell MP, Lee HS, Keane WF. Early glomerular changes in rats with dietary-induced hypercholesterolemia. Am J Kidney Dis. 1995; 26: 152161.[Medline] [Order article via Infotrieve]
22. Miyajima A, Chen J, Lawrence C, Ledbetter S, Soslow RA, Stern J, Jha S, Pigato J, Lemer ML, Poppas DP, Vaughan ED, Felsen D. Antibody to transforming growth factor-beta ameliorates tubular apoptosis in unilateral ureteral obstruction. Kidney Int. 2000; 58: 23012313.[CrossRef][Medline] [Order article via Infotrieve]
23. Benigni A, Zoja C, Corna D, Zatelli C, Conti S, Campana M, Gagliardini E, Rottoli D, Zanchi C, Abbate M, Ledbetter S, Remuzzi G. Add-on anti-TGF-beta antibody to ACE inhibitor arrests progressive diabetic nephropathy in the rat. J Am Soc Nephrol. 2003; 14: 18161824.
24. Hanefeld M, Abletshauser C. Effect of the angiotensin II receptor antagonist valsartan on lipid profile and glucose metabolism in patients with hypertension. J Int Med Res. 2001; 29: 270279.[Medline] [Order article via Infotrieve]
25. Okada K, Hirano T, Ran J, Adachi M. Olmesartan medoxomil, an angiotensin II receptor blocker ameliorates insulin resistance and decreases triglyceride production in fructose-fed rats. Hypertens Res. 2004; 27: 293299.[CrossRef][Medline] [Order article via Infotrieve]
26. Ran J, Hirano T, Adachi M. Chronic Ang II infusion increases plasma triglyceride level by stimulating hepatic triglyceride production in rats. Am J Physiol Endocrinol Metab. 2004; 287: E955E961.
27. Kim S, Dugail I, Standridge M, Claycombe K, Chun J, Moustaid-Moussa N. Angiotensin II-responsive element is the insulin-responsive element in the adipocyte fatty acid synthase gene: role of adipocyte determination and differentiation factor 1/sterol-regulatory-element-binding protein 1c. Biochem J. 2001; 357: 899904.[CrossRef][Medline] [Order article via Infotrieve]
28. Sun L, Halaihel N, Zhang W, Rogers T, Levi M. Role of sterol regulatory element-binding protein 1 in regulation of renal lipid metabolism and glomerulosclerosis in diabetes mellitus. J Biol Chem. 2002; 277: 1891918927.
29. Neuman M, West M, Zimmerman HJ. The relationship between proteinuria and fatty elements in the urine sediment. Am J Med Sci. 1961; 241: 617624.[Medline] [Order article via Infotrieve]
30. Chatterjee S, Kwiterovich PO Jr, Gupta P, Erozan YS, Alving CR, Richards RL. Localization of urinary lactosylceramide in cytoplasmic vesicles of renal tubular cells in homozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1983; 80: 13131317.
31. Cutler P. Deferoxamine therapy in high-ferritin diabetes. Diabetes. 1989; 38: 12071210.[Abstract]
32. Zager RA, Johnson AC, Hanson SY, Shah VO. Acute tubular injury causes dysregulation of cellular cholesterol transport proteins. Am J Pathol. 2003; 163: 313320.
33. Johnson AC, Yabu JM, Hanson S, Shah VO, Zager RA. Experimental glomerulopathy alters renal cortical cholesterol, SR-B1, ABCA1, and HMG CoA reductase expression. Am J Pathol. 2003; 162: 283291.
34. Uehara Y, Urata H, Ideishi M, Arakawa K, Saku K. Chymase inhibition suppresses high-cholesterol diet-induced lipid accumulation in the hamster aorta. Cardiovasc Res. 2002; 55: 870876.
35. Sambhi MP, Swaminathan N, Wang H, Rong H. Increased EGF binding and EGFR mRNA expression in rat aorta with chronic administration of pressor angiotensin II. Biochem Med Metab Biol. 1992; 48: 818.[CrossRef][Medline] [Order article via Infotrieve]
36. Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura K, Inada Y, Ishimura Y, Chatani F, Iwao H. Angiotensin II type I receptor antagonist inhibits the gene expression of transforming growth factor-beta 1 and extracellular matrix in cardiac and vascular tissues of hypertensive rats. J Pharmacol Exp Ther. 1995; 273: 509515.
This article has been cited by other articles:
![]() |
I. M. Wahba and R. H. Mak Obesity and Obesity-Initiated Metabolic Syndrome: Mechanistic Links to Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., May 1, 2007; 2(3): 550 - 562. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |