Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2005;46:1180-1185
Published online before print October 3, 2005, doi: 10.1161/01.HYP.0000184653.75036.d5
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/5/1180    most recent
01.HYP.0000184653.75036.d5v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saito, K.
Right arrow Articles by Nagai, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saito, K.
Right arrow Articles by Nagai, R.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DESFERRIOXAMINE
*IRON
Related Collections
Right arrow Lipids

(Hypertension. 2005;46:1180.)
© 2005 American Heart Association, Inc.


Original Articles

Lipid Accumulation and Transforming Growth Factor-ß Upregulation in the Kidneys of Rats Administered Angiotensin II

Kan Saito; Nobukazu Ishizaka; Masumi Hara; Gen Matsuzaki; Masataka Sata; Ichiro Mori; Minoru Ohno; Ryozo Nagai

From the Departments of Cardiovascular Medicine (N.I., K.S., G.M., M.S., M.O., N.R.), and Diabetes and Metabolic Disease (M.H.), University of Tokyo Graduate School of Medicine, Japan; and Department of Pathology (I.M.), Wakayama Medical College, Japan.

Reprint requests to Nobukazu Ishizaka, MD, PhD, Department of Cardiovascular Medicine, University of Tokyo, Graduate School of Medicine, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-8655, Japan. E-mail nobuishizka-tky{at}umin.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abnormal lipid metabolism may play a role in progressive renal failure. We studied whether lipid accumulation occurs and whether lipid deposits are colocalized with transforming growth factor-ß1 (TGF-ß1) in the kidney of angiotensin II–infused animals. Oil red O staining showed marked lipid deposition in the tubular epithelial and vascular wall cells of angiotensin II–treated but not in norepinephrine-treated rats. Histological analyses showed that increased amounts of superoxide and intense TGF-ß1 mRNA expression were present in lipid-positive tubular epithelial cells in angiotensin II–infused animals. Protein expression of sterol regulatory element-binding protein 1 (SREBP-1) and mRNA expression of fatty acid synthase in the kidney were &3 times and 1.5 times, respectively, higher in angiotensin II–treated rats than in controls. Treatment of angiotensin II–infused animals with an iron chelator, deferoxamine, attenuated the angiotensin II–induced increases in renal expression of SREBP-1 and fatty acid synthase and normalized the lipid content in the renal cortical tissues. Abnormal lipid metabolism may be associated with upregulation of TGF-ß1 expression and aberrant iron homeostasis in the kidneys of angiotensin II–infused animals.


Key Words: angiotensin II • transforming growth factors • lipids


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Previous studies showed that accumulation of lipids in nonadipose tissues occurs in certain diseased conditions, and that it plays a crucial role in the pathogenesis of tissue damage,1 a phenomenon referred to as lipotoxicity.2 For example, lipid deposition in the arterial wall3,4 is postulated to represent an early event in the development of atherosclerosis.5 The accumulation of triglycerides (TGs) in cardiomyocytes6,7 may be associated with contractile dysfunction, and excess TGs in the liver may promote hepatic fibrosis.8 Lipid accumulation in the kidney may represent features of glomerular and tubulointerstitial damage.9

We found that long-term administration of angiotensin II (Ang II) to rats caused marked deposition of iron10 and upregulation of the expression of transforming growth factor-ß1 (TGF-ß1) in renal tubular epithelial cells.11 We also found that iron chelation attenuated the Ang II–induced upregulation of TGF-ß1 in the kidney, suggesting a possible link between aberrant iron homeostasis and TGF-ß1 upregulation. However, unexpectedly, histological analysis showed that upregulation of TGF-ß1 mRNA and deposition of iron occurred in different tubular cells in most cases. The aims of the present study were to investigate whether accumulation of lipids occurs in the kidney of Ang II–infused animals and to investigate the relationship between lipid accumulation and TGF-ß1 in terms of localization. We also investigated whether Ang II infusion alter the expression of genes that have relation to the lipid metabolism, such as ATP-binding cassette transporter subfamily A-1 (ABCA1), scavenger receptor class B type 1 (SR-B1), sterol regulatory element-binding protein 1 (SREBP-1), SREBP-2, 3-hydroxy-3-methylglutaryl–coenzyme A (HMG-CoA) reductase, acetyl-CoA carboxylase (ACC), stearoyl-CoA desaturase-1 (SCD-1), CoA:diacylglycerol acyltransferase-1 (DGAT-1), and LDL receptor. Furthermore, we investigated whether iron chelation affects the degree of lipid accumulation in the kidney of Ang II–infused animals.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animal Models
The experiments were performed in accordance with the guidelines for animal experimentation approved by the Animal Center for Biomedical Research, Faculty of Medicine, University of Tokyo. Ang II–induced hypertension was induced in male Sprague-Dawley rats (250 to 300 g) by subcutaneous implantation of an osmotic minipump (Alzet model 2001; Alza Pharmaceutical) as described previously.12 Briefly, Val5-Ang II (Sigma Chemical) and norepinephrine (Sigma Chemical) were infused at doses of 0.7 mg/kg per day and 2.8 mg/kg per day, respectively, for 7 days.12 An iron chelator, deferoxamine (a kind gift from Novartis, Basel, Switzerland) was subcutaneously administered at a dose of 200 mg/kg per day while rats were receiving Ang II. Deferoxamine did not significantly affect the blood pressure of Ang II–infused rats.

Measurement of Lipid Contents in the Serum and Renal Cortex
Serum levels of total cholesterol (TC) and TGs in each sample were measured by enzymatic methods (SRL) using Total Cholesterol E Test Wako and Triglycerides E Test Wako (Wako Pure Chemicals), respectively.

Western Blot Analysis, Immunohistochemistry, and In Situ Hybridization
Western blot analysis was performed as described previously.13 Polyclonal antibodies against ABCA1 (Novus Biologicals), SR-B1 (Novus Biologicals), SREBP-1 (Santa Cruz Biotechnology), and SREBP-2 (Santa Cruz Biotechnology) were used at dilutions of 1/1000, 1/1000, and 1/500, respectively. Immunohistochemistry was performed as described previously.13 For this purpose anti–SREBP-1 antibody was used at a dilution of 1/200. In situ hybridization was performed as described previously.11

Oxidative Fluorescent Microscopy
Staining with the oxidative fluorescent dye dihydroethidium (DHE) was performed as described previously.11 Fluorescence intensity was obtained for ≥6 fields for each section. The fluorescent intensity in Ang II–treated group was presented as the percentage of that of untreated control group.

Real-Time RT-PCR
Real-time quantitative PCR was performed by LightCycler (Roche Diagnostics). Gene expression was normalized to the endogenous control GAPDH mRNA in each sample, and then the amount of target gene expression in the sample from treated animals was expressed as the percentage of that in the untreated control. The following primers and probes were used: for HMG-CoA reductase: forward 5' GACACTTACAATCTGTATGATG 3'; reverse 5' CTTGGAGAGGTAAAACTGCCA 3'; for ACC: forward 5' GAATTTGTCACCCGCTTTGG 3', reverse 5' TGGAGCGCATCCACTTGA 3'; for SCD-1: forward 5' CCTTAACCCTGAGATCCCGTAGA 3', reverse 5' AGCCCATAAAAGATTTCTGCAAA 3'; for DGAT-1, forward: 5' TCTTCCTACCGGGATGTCAATC 3', reverse 5' TCCCTGCAGACACAGCTTTG 3'; for LDL receptor, forward: 5' TCCTCATCCTGCCTAAGT 3, reverse 5' TGTAGTGCTTGTGCTACAGAG 3'; for plasminogen activator inhibitor-1 (PAI-1), forward: 5' TCCTCATCCTGCCTAAGT 3', reverse 5' TGTAGTGCTTGTGCTACAGAG 3'; and for GAPDH: forward 5' TGAACGGGAAGCTCACTGG 3', reverse 5' TCCACCACCCTGTTGCTGTA 3'.

Statistical Analysis
Data are expressed as the mean±SEM. We used ANOVA followed by a multiple comparison test to compare raw data before expressing the results as a percentage of the control value using the statistical analysis software Statistica version 5.1 J for Windows (StatSoft Inc). A value of P<0.05 was considered to be statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Serum and Tissue Lipids Contents
Administration of Ang II for 7 days slightly but significantly increased the serum levels of TC and TGs compared with the respective levels in control rats. These increases in the serum TC and TG levels were suppressed by treatment with an iron chelator (Table 1). Similarly, Ang II increased the contents of TC and TGs in the renal cortical tissues, and these increases were suppressed by treatment with an iron chelator (Table 2). A pressor dose of norepinephrine did not increase the serum levels of TC or TGs nor the content of TC or TGs in renal cortical tissues.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Body Weight, Blood Pressure, and Serum Levels of TC and TGs


View this table:
[in this window]
[in a new window]
 
TABLE 2. Lipid Contents in the Renal Cortex

Lipid Staining
Oil red O staining of kidney sections showed no apparent lipid deposition in the kidneys of untreated rats (Figure 1A). On the other hand, in Ang II–infused rats, marked accumulation of oil red O–stainable lipid was observed in tubular epithelial cells in kidney sections (Figure 1B). Lipid deposition was not apparent in kidney sections from the norepinephrine-infused rats (Figure 1C). Staining of serial sections showed that lipid deposits that were positively stained by oil red O (Figure 1D) could also be stained positively by Sudan black (Figure 1E). In Ang II–infused rats, the percentage of cells that were positive for iron deposition decreased after the treatment with an iron chelator (Figure 1F).



View larger version (115K):
[in this window]
[in a new window]
 
Figure 1. Lipid staining. A, Kidney section from a control rat. B, D, and E, Kidney sections from Ang II–infused rats. C, Kidney section from a norepinephrine (NE)-infused rat. F, Kidney section from a rat treated with Ang II and deferoxamine (DFO). D and E are serial sections. Lipid droplets were not observed in the kidney of control rats (A). Marked lipid droplets, mainly in the tubular epithelium, were observed by oil red O staining in the kidney of hypertensive rats induced by Ang II (B) but not by NE (C). Lipid droplets shown by oil red O staining (D) were also stained positive for Sudan black (E). Iron chelation seemed to decrease the fraction of tubular cells with lipid deposition (F). Original magnification x200.

Staining for Superoxide, Lipids, and Iron
We previously found that superoxide production was increased in tubular epithelial cells that contain granular materials in the kidneys of Ang II–infused rats,11 and that majority of the cells that contained these granular materials were not positive for iron staining.10,11 In the current study, staining of serial sections showed that tubular cells found to contain granular material on differential interference contrast (DIC) images were positive for oil red O staining, indicating that observed granular materials are lipid droplets (Figure 2A and 2B). Cells with granular materials (ie, lipid droplets) had increased superoxide production (Figure 2B through 2G), which is consistent with a previous report.11 The levels of superoxide detected by DHE oxidation were increased after Ang II administration (control 100±10%, n=4 versus Ang II 209±30%, n=4; P<0.01). Only a small fraction of lipid-positive cells were found to be positive for iron deposition (Figure 2H and 2I, asterisks), which is again consistent with previous findings.11



View larger version (147K):
[in this window]
[in a new window]
 
Figure 2. Lipid, superoxide, and iron staining. A and H, Oil red O staining. B and E, Nomarski DIC image. C and F, DHE staining. D and G, Overlay. I, Iron staining. A and B and H and I are serial sections. B through D (higher magnifications) and E through G (lower magnifications) are the same sections. Although lipid deposition and iron deposition are observed in different tubular cells in most cases, colocalization could be observed in some tubular cells (H and I, asterisks). Original magnification x200 (A, H, and I). Bar=20 µm (C and F). GM indicates glomerulus.

In Situ Hybridization for TGF-ß1
The antisense but not sense (Figure 3A) probes for TGF-ß1 mRNA showed positive staining in tubular epithelial cells (Figure 3B and 3D). Cells that expressed increased levels of TGF-ß1 mRNA contained oil red O–stainable lipid deposits (Figure 3C and 3E). Higher magnification revealed that cells with increased levels of TGF-ß1 mRNA contained lucid granular materials, which were presumably lipid droplets (Figure 3F). Lipid deposition was occasionally observed in the vascular wall cells, in which increased TGF-ß1 mRNA expression was observed (Figure 3G and 3H). On the other hand, vascular wall cells that did not contain lipid deposition did not express increased levels of TGF-ß1 mRNA (Figure 3I and 3J).



View larger version (79K):
[in this window]
[in a new window]
 
Figure 3. Lipid staining and in situ hybridization for TGF-ß1 mRNA. Sections of unfixed frozen kidney samples were used. A, In situ hybridization using the TGF-ß1 sense probe (background). B, D, F, H, and J, In situ hybridization using the TGF-ß1 antisense probe. A through C, D and E, G and H, and I and J are serial sections. Tubular epithelial cells with increased expression of TGF-ß1 mRNA are also positive for lipid deposition (B and C x200; D and E x100). Higher magnification shows granular materials in the cells with increased expression of TGF-ß1 mRNA (F). Vascular wall cells with lipid deposits (G) expressed increased levels of TGF-ß1 mRNA (H), and those without lipid deposits (I) did not express increased levels of TGF-ß1 mRNA (J). Also note that tubular cells that contain lipid droplets (I) expressed an increase level of TGF-ß1 mRNA (J). Original magnifications x200 (A through C and G through J); x100 (D and E); and x400 (F).

Regulation of Genes Related to Lipid Metabolism and PAI-1
Western blot analysis showed that the expression of SREBP-1 and ABCA1 but not AR-B1 was increased in the kidneys of Ang II–treated animals (Figure 4A and 4B). Administration of norepinephrine did not significantly alter the expression of SREBP-1, and Ang II–induced upregulation of SREBP-1 was suppressed by iron chelation. (Figure 4C and 4D). Immunohistochemical and histological analysis showed that Ang II increased protein expression of SREBP-1 in the tubular cells, where deposition of oil red O–stainable lipid was positive (Figure 5).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. Western blot analysis of genes related to lipid metabolism. A and B, Expression of ABCA1, SR-B1, SREBP-1, and SREBP-2 in the kidney of Ang II–infused animals. A, Representative Western blots. The size of the SREBP-1 bands shown in the figures was &70 kDa and thus judged to correspond to the mature form. B, Summary of data from 5 to 7 experiments in each group. C and D, Effects of iron chelation and norepinephrine on SREBP-1 expression. C, Representative Western blots. D, Summary of data from 5 to 7 experiments in each group.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 5. Localization of SREBP-1 and lipids. A through C, SREBP-1 staining. D, Oil red O staining. A, Kidney section from a control rat. B through D. Kidney sections from Ang II–infused rats. C and D are serial sections. Original magnifications x200 (A and B); x400 (C and D).

Expression of HMG-CoA reductase, ACC, SCD-1, DGAT-1, LDL receptor, and fatty acid synthase (FAS) in the control kidney were examined by quantitative RT-PCR. In the kidney of control (n=10) and Ang II–infused (n=11) animals, expression of these genes were as follows: HMG-CoA reductase 100±7% versus 129±18%, respectively (P=NS); ACC 100±7% versus 84±5%, respectively (P=NS); SCD-1 100±41% versus 99±50%, respectively (P=NS); DGAT-1 100±17% versus 83±8, respectively (P=NS); LDL receptor 100±30% versus 165±20%, respectively (P<0.05); and FAS 100±10% versus 153±25%, respectively (P<0.05). Deferoxamine suppressed Ang II–induced upregulation of LDL receptor (76±9%; n=5; P=NS versus control) and FAS mRNA (70±19%; n=6; P=NS versus control). Ang II infusion increased PAI-1 mRNA expression in the kidney (control 100±22%; n=11 versus Ang II 191±24%, n=10; P<0.01), which was again suppressed by deferoxamine (137±30%; n=5; P=NS versus control).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we showed that long-term administration of Ang II but not norepinephrine caused robust accumulation of oil red O–stainable lipid in tubular epithelial cells and vascular wall cells in the rat kidney. Increased expression of TGF-ß1 mRNA, shown by in situ hybridization, and increased amount of superoxide, shown by DHE staining, were observed in cells with lipid deposition.

We showed previously that administration of Ang II to rats induces the expression of ferritin and heme oxygenase-1,13 an enzyme for heme degradation, in the renal tubular cells,10 and that tubular epithelial cells with increased expression of these proteins were positive for Prussian blue–stainable iron.10 We found that Ang II–induced aberrant iron homeostasis may have modulatory effects on the extent of urinary protein excretion10 and on the expression of genes that have relation to anti-aging14 and fibrogenesis.11 However, notably, in situ hybridization showed that the localization of upregulation of TGF-ß1 mRNA and deposition of iron were found to occur in different renal tubular cells.11 In addition, cells that contain granular materials observed by DIC were also negative for iron staining.11 In the current study, the granular materials observed in the tubular cells were identified as lipid droplets, and cells with lipid deposition were found to have intense expression of TGF-ß1 mRNA and increased levels of superoxide.

Lipid deposition in the kidney may not be a rare phenomenon in certain animal models15–17 and in humans.18 Several investigators advocated that it may play a crucial role in the development of renal damage, which might be, in part, mediated by the peroxydized lipids.17,19,20 Guijarro et al21 reported that dietary-induced hyperlipidemia increased the renal expression of collagen and TGF-ß.22,23 Eddy et al20 showed that diet-induced hypercholesterolemia induced renal lipid deposition and upregulation of TGF-ß expression in the kidney of uninephrectomized rats. To the best of our knowledge, the present study is the first to demonstrate the colocalization of lipid deposits and increased TGF-ß1 mRNA expression in animal models of human diseases.

Several previous studies suggested that Ang II may affect circulating lipid content. Hanefeld et al24 showed that treatment of hypertensive patients with Ang II type 1 (AT1) receptor blocker significantly reduced the plasma TC level. The AT1 receptor blocker was potent in reducing the plasma TG level,25 and conversely, Ang II infusion increased the plasma TG levels by stimulating hepatic TG production in rats.26 In our animal models, the plasma levels of TC and TGs also increased after Ang II infusion. Thus, it is possible that lipid deposition in the kidney occurred in response to the increased level of circulating lipids.

In the present study, we also found that expression of SREBP-1 and FAS was increased in the kidney of Ang II–infused animals. Previous studies showed the possible link between Ang II and FAS expression in the adipocyte.27 Our data suggested that Ang II may also increase FAS expression in the kidney, which might result in the increased production of lipids. Sun et al28 reported that SREBP-1 expression is upregulated in the kidney of diabetic animals. Interestingly, Sun et al also showed that induction of SREBP-1 caused upregulation of not only FAS but also of TGF-ß1 in the kidney.28 Together with our findings, it is suggested that altered renal expression of lipogenesis-related genes may play a crucial role in the regulation of TGF-ß1 expression. We also found that Ang II infusion increased the renal expression of LDL receptor. Whether this phenomenon is the underlying mechanism of increase in the cortical TC content after Ang II infusion should be investigated in future experiments.

Although underlying mechanisms that link between iron and lipid dysregulation in the kidney remain unknown, there are several possibilities. First, tubular cells in proteinuric states carry large amounts of lipids, and fatty elements may be correlated with the degree of proteinuria.29 Thus, iron chelation may have suppressed renal lipid deposition by decreasing the urinary excretion of protein.10 Second, in the current study, iron chelation reduced the increase in plasma lipid content in Ang II–infused animals. Because hyperlipidemia may cause lipid accumulation in the renal tubular cells,30 deferoxamine may have suppressed renal lipid accumulation by lowering circulating lipids.31 Third, Zager et al32,33 reported the possible relationship between (heme) iron overload and regulation of lipogenesis-related genes in the kidney.32 We found that expression of Ang II–induced upregulation of FAS mRNA was inhibited by iron chelation. Thus, aberrant iron homeostasis may directly modulate expression of lipogenesis-related genes in the kidney. However, if so, whether certain paracrine substances would be released from the iron-positive cells that may alter the expression of lipogenesis-related genes should be investigated because iron deposition and lipid accumulation occurred in the different tubular cells.

In the present study, Ang II infusion also induced lipid deposition in the vascular wall cells, in which TGF-ß1 mRNA expression was found to be upregulated. It has been shown that Ang II plays a crucial role in the lipid deposition in the arterial wall, an early event of atherogenic processes,34 and TGF-ß upregulation in the aortas.35,36 We are now examining whether upregulation of TGF-ß1 mRNA in the kidney is a downstream event of lipid deposition and whether lipid deposition also occurs in the aorta in the Ang II–infused rat.

In conclusion, long-term administration of Ang II caused robust accumulation of lipids in the rat kidney. TGF-ß1 mRNA expression and superoxide production were found to be increased in renal tubular cells and vascular wall cells that contained oil red O–stainable lipids. Iron chelation suppressed the increases in serum lipid levels and in the lipid content of the renal cortical tissues in Ang II–infused rats. These findings collectively suggest the existence of a relationship among altered lipid metabolism, aberrant iron homeostasis, and the extent of renal injury in the kidneys of Ang II–infused rats.


*    Acknowledgments
 
This work was supported by grants in aid for scientific research from the Ministry of Education, Science, and Culture of Japan (13671098). We are highly appreciative of Kyoko Furuta, Kazuko Komatsumoto, and Naoko Amitani for their excellent technical assistance.

Received March 28, 2005; first decision April 16, 2005; accepted August 24, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Schaffer JE. Lipotoxicity: when tissues overeat. Curr Opin Lipidol. 2003; 14: 281–287.[CrossRef][Medline] [Order article via Infotrieve]

2. Unger RH. Lipotoxic diseases. Annu Rev Med. 2002; 53: 319–336.[CrossRef][Medline] [Order article via Infotrieve]

3. Barnes SE, Weinberg PD. Two patterns of lipid deposition in the cholesterol-fed rabbit. Arterioscler Thromb Vasc Biol. 1999; 19: 2376–2386.[Abstract/Free Full Text]

4. Nunnari JJ, Fisher M, White SD. Inhibition of lipid deposition in the hypercholesterolemic rat by clentiazem, a calcium channel blocker. Exp Mol Pathol. 1992; 57: 193–204.[CrossRef][Medline] [Order article via Infotrieve]

5. Rogers KA, Karnovsky MJ. A rapid method for the detection of early stages of atherosclerotic lesion formation. Am J Pathol. 1988; 133: 451–455.[Abstract]

6. Sharma S, Adrogue JV, Golfman L, Uray I, Lemm J, Youker K, Noon GP, Frazier OH, Taegtmeyer H. Intramyocardial lipid accumulation in the failing human heart resembles the lipotoxic rat heart. FASEB J. 2004; 18: 1692–1700.[Abstract/Free Full Text]

7. Zhou YT, Grayburn P, Karim A, Shimabukuro M, Higa M, Baetens D, Orci L, Unger RH. Lipotoxic heart disease in obese rats: implications for human obesity. Proc Natl Acad Sci U S A. 2000; 97: 1784–1789.[Abstract/Free Full Text]

8. Ramesh S, Sanyal AJ. Hepatitis C and nonalcoholic fatty liver disease. Semin Liver Dis. 2004; 24: 399–413.[CrossRef][Medline] [Order article via Infotrieve]

9. Moorhead JF, Chan MK, El-Nahas M, Varghese Z. Lipid nephrotoxicity in chronic progressive glomerular and tubulo-interstitial disease. Lancet. 1982; 2: 1309–1311.[Medline] [Order article via Infotrieve]

10. Ishizaka N, Aizawa T, Yamazaki I, Usui S, Mori I, Kurokawa K, Tang SS, Ingelfinger JR, Ohno M, Nagai R. Abnormal iron deposition in renal cells in the rat with chronic angiotensin II administration. Lab Invest. 2002; 82: 87–96.[Medline] [Order article via Infotrieve]

11. Saito K, Ishizaka N, Aizawa T, Sata M, Iso ON, Noiri E, Ohno M, Nagai R. Role of aberrant iron homeostasis in the upregulation of transforming growth factor-beta1 in the kidney of angiotensin II-induced hypertensive rats. Hypertens Res. 2004; 27: 599–607.[CrossRef][Medline] [Order article via Infotrieve]

12. Ishizaka N, de Leon H, Laursen JB, Fukui T, Wilcox JN, De Keulenaer G, Griendling KK, Alexander RW. Angiotensin II-induced hypertension increases heme oxygenase-1 expression in rat aorta. Circulation. 1997; 96: 1923–1929.[Abstract/Free Full Text]

13. Aizawa T, Ishizaka N, Taguchi J, Nagai R, Mori I, Tang SS, Ingelfinger JR, Ohno M. Heme oxygenase-1 is upregulated in the kidney of angiotensin II-induced hypertensive rats: possible role in renoprotection. Hypertension. 2000; 35: 800–806.[Abstract/Free Full Text]

14. Saito K, Ishizaka N, Mitani H, Ohno M, Nagai R. Iron chelation and a free radical scavenger suppress angiotensin II-induced downregulation of klotho, an anti-aging gene, in rat. FEBS Lett. 2003; 551: 58–62.[CrossRef][Medline] [Order article via Infotrieve]

15. Fujihara CK, Padilha RM, Zatz R. Glomerular abnormalities in long-term experimental diabetes. Role of hemodynamic and nonhemodynamic factors and effects of antihypertensive therapy. Diabetes. 1992; 41: 286–293.[Abstract]

16. Coimbra TM, Janssen U, Grone HJ, Ostendorf T, Kunter U, Schmidt H, Brabant G, Floege J. Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes. Kidney Int. 2000; 57: 167–182.[CrossRef][Medline] [Order article via Infotrieve]

17. Chander PN, Gealekman O, Brodsky SV, Elitok S, Tojo A, Crabtree M, Gross SS, Goligorsky MS. Nephropathy in Zucker diabetic fat rat is associated with oxidative and nitrosative stress: prevention by chronic therapy with a peroxynitrite scavenger ebselen. J Am Soc Nephrol. 2004; 15: 2391–2403.[Abstract/Free Full Text]

18. Lee HS, Lee JS, Koh HI, Ko KW. Intraglomerular lipid deposition in routine biopsies. Clin Nephrol. 1991; 36: 67–75.[Medline] [Order article via Infotrieve]

19. Dominguez JH, Tang N, Xu W, Evan AP, Siakotos AN, Agarwal R, Walsh J, Deeg M, Pratt JH, March KL, Monnier VM, Weiss MF, Baynes JW, Peterson R. Studies of renal injury III: lipid-induced nephropathy in type II diabetes. Kidney Int. 2000; 57: 92–104.[CrossRef][Medline] [Order article via Infotrieve]

20. Eddy AA. Interstitial inflammation and fibrosis in rats with diet-induced hypercholesterolemia. Kidney Int. 1996; 50: 1139–1149.[Medline] [Order article via Infotrieve]

21. Guijarro C, Kasiske BL, Kim Y, O’Donnell MP, Lee HS, Keane WF. Early glomerular changes in rats with dietary-induced hypercholesterolemia. Am J Kidney Dis. 1995; 26: 152–161.[Medline] [Order article via Infotrieve]

22. Miyajima A, Chen J, Lawrence C, Ledbetter S, Soslow RA, Stern J, Jha S, Pigato J, Lemer ML, Poppas DP, Vaughan ED, Felsen D. Antibody to transforming growth factor-beta ameliorates tubular apoptosis in unilateral ureteral obstruction. Kidney Int. 2000; 58: 2301–2313.[CrossRef][Medline] [Order article via Infotrieve]

23. Benigni A, Zoja C, Corna D, Zatelli C, Conti S, Campana M, Gagliardini E, Rottoli D, Zanchi C, Abbate M, Ledbetter S, Remuzzi G. Add-on anti-TGF-beta antibody to ACE inhibitor arrests progressive diabetic nephropathy in the rat. J Am Soc Nephrol. 2003; 14: 1816–1824.[Abstract/Free Full Text]

24. Hanefeld M, Abletshauser C. Effect of the angiotensin II receptor antagonist valsartan on lipid profile and glucose metabolism in patients with hypertension. J Int Med Res. 2001; 29: 270–279.[Medline] [Order article via Infotrieve]

25. Okada K, Hirano T, Ran J, Adachi M. Olmesartan medoxomil, an angiotensin II receptor blocker ameliorates insulin resistance and decreases triglyceride production in fructose-fed rats. Hypertens Res. 2004; 27: 293–299.[CrossRef][Medline] [Order article via Infotrieve]

26. Ran J, Hirano T, Adachi M. Chronic Ang II infusion increases plasma triglyceride level by stimulating hepatic triglyceride production in rats. Am J Physiol Endocrinol Metab. 2004; 287: E955–E961.[Abstract/Free Full Text]

27. Kim S, Dugail I, Standridge M, Claycombe K, Chun J, Moustaid-Moussa N. Angiotensin II-responsive element is the insulin-responsive element in the adipocyte fatty acid synthase gene: role of adipocyte determination and differentiation factor 1/sterol-regulatory-element-binding protein 1c. Biochem J. 2001; 357: 899–904.[CrossRef][Medline] [Order article via Infotrieve]

28. Sun L, Halaihel N, Zhang W, Rogers T, Levi M. Role of sterol regulatory element-binding protein 1 in regulation of renal lipid metabolism and glomerulosclerosis in diabetes mellitus. J Biol Chem. 2002; 277: 18919–18927.[Abstract/Free Full Text]

29. Neuman M, West M, Zimmerman HJ. The relationship between proteinuria and fatty elements in the urine sediment. Am J Med Sci. 1961; 241: 617–624.[Medline] [Order article via Infotrieve]

30. Chatterjee S, Kwiterovich PO Jr, Gupta P, Erozan YS, Alving CR, Richards RL. Localization of urinary lactosylceramide in cytoplasmic vesicles of renal tubular cells in homozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1983; 80: 1313–1317.[Abstract/Free Full Text]

31. Cutler P. Deferoxamine therapy in high-ferritin diabetes. Diabetes. 1989; 38: 1207–1210.[Abstract]

32. Zager RA, Johnson AC, Hanson SY, Shah VO. Acute tubular injury causes dysregulation of cellular cholesterol transport proteins. Am J Pathol. 2003; 163: 313–320.[Abstract/Free Full Text]

33. Johnson AC, Yabu JM, Hanson S, Shah VO, Zager RA. Experimental glomerulopathy alters renal cortical cholesterol, SR-B1, ABCA1, and HMG CoA reductase expression. Am J Pathol. 2003; 162: 283–291.[Abstract/Free Full Text]

34. Uehara Y, Urata H, Ideishi M, Arakawa K, Saku K. Chymase inhibition suppresses high-cholesterol diet-induced lipid accumulation in the hamster aorta. Cardiovasc Res. 2002; 55: 870–876.[Abstract/Free Full Text]

35. Sambhi MP, Swaminathan N, Wang H, Rong H. Increased EGF binding and EGFR mRNA expression in rat aorta with chronic administration of pressor angiotensin II. Biochem Med Metab Biol. 1992; 48: 8–18.[CrossRef][Medline] [Order article via Infotrieve]

36. Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura K, Inada Y, Ishimura Y, Chatani F, Iwao H. Angiotensin II type I receptor antagonist inhibits the gene expression of transforming growth factor-beta 1 and extracellular matrix in cardiac and vascular tissues of hypertensive rats. J Pharmacol Exp Ther. 1995; 273: 509–515.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
CJASNHome page
I. M. Wahba and R. H. Mak
Obesity and Obesity-Initiated Metabolic Syndrome: Mechanistic Links to Chronic Kidney Disease
Clin. J. Am. Soc. Nephrol., May 1, 2007; 2(3): 550 - 562.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
46/5/1180    most recent
01.HYP.0000184653.75036.d5v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saito, K.
Right arrow Articles by Nagai, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saito, K.
Right arrow Articles by Nagai, R.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DESFERRIOXAMINE
*IRON
Related Collections
Right arrow Lipids