| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2005;46:1340.)
© 2005 American Heart Association, Inc.
Original Articles |
From the Institut für Physiologie (J.K., M.S., B.O., F.S., A.K.), Universität Regensburg, and Innere Medizin II (B.K.K.), Universität-Klinikum Regensburg, Regensburg, Germany.
Correspondence to Jürgen Klar, Institut für Physiologie, Universität Regensburg, D-93040 Regensburg, Germany. E-mail juergen.klar{at}vkl.uni-regensburg.de
| Abstract |
|---|
|
|
|---|
3 transcription factor-binding sites are involved in this process. In addition, thapsigargin reduced the renin mRNA half-life from 10 hours (control conditions) to 4 hours. Knockdown studies with small interfering RNA directed to dynamin-1 mRNA revealed that dynamin-1 is likely to be involved in the calcium-mediated destabilization of renin mRNA. These data suggest that calcium inhibits renin gene expression in juxtaglomerular cells via a concerted action of inhibition of renin gene transcription and destabilization of renin mRNA.
Key Words: calcium renin-angiotensin-aldosterone system thapsigargin mRNA stability
| Introduction |
|---|
|
|
|---|
The focus of our study was to investigate the role of calcium in the regulation of renin gene expression. This is of particular interest, because vasoactive peptides like angiotensin II or endothelin-1, which are known to be direct regulators of renin gene expression, activate the phospholipase C via a G protein-coupled receptor and, in turn, increase inositol triphosphate and diacylglycerol (DAG).3 Whereas DAG is known to activate protein kinase C, inositol triphosphate increases the cytosolic calcium concentration [Ca2+]c. However, it is still a matter of controversy regarding which one of these intracellular factors translates into an inhibitory signal on renin gene expression in juxtaglomerular cells. Ryan et al6 have reported that endothelin-1 increases the intracellular calcium concentration in As4.1 cells and that this increase is paralleled by a decrease in the renin gene transcription. Pan et al7 provided evidence that a HOX.PBX binding site at 60 bp and also the enhancer region of the renin gene are involved in the negative regulation of the renin gene by endothelin-1. Studies with the human renin promoter showed that increases in the cytosolic calcium concentration are accompanied by a binding of the ref-1 transcription factor to a nCaRE sequence in the renin promoter in choriodecidual cells.8
Therefore, we investigated the effect of calcium on renin gene expression and addressed the intracellular mechanisms involved in this process. For this purpose, we used the immortalized juxtaglomerular cell line As4.1. To increase cytosolic calcium concentration, we used inhibitors of the endoplasmatic reticulum calcium ATPase. From our data, we infer that an increase in the intracellular calcium concentration decreases renin gene expression. This process is independent of protein kinase C activity. This downregulation of renin gene expression is mediated by inhibition of renin gene transcription and by a destabilization of the renin mRNA.
| Methods |
|---|
|
|
|---|
RNA Interference
Ready-to-use double-stranded 21-nucleotide small interfering RNAs (siRNAs) were synthesized by IBA. The siRNA targeting ref-1 (GenBank accession no. NM_009687) corresponded to position 94 to 113 relative to the first nucleotide of the start codon. The siRNA targeting dynamin 1 (GenBank accession no. L31397) corresponded to position 41 to 60 relative to the first nucleotide of the start codon. Single-stranded sense RNA (used as control) or siRNA (200 nmol/L) was transfected in As4.1 cells with oligofectamine (Invitrogen) according to the manufacturers protocol. Cells were harvested 72 hours after transfection.
RNA Isolation and Ribonuclease Protection Assay
Total RNA was isolated from As4.1 cells using Qiagen RNeasy Spin Columns. RNA protection assay was done as described.11
Reverse Transcriptase Reaction and Quantitative PCR Analysis
Reverse transcription and quantitative PCR analysis was performed as described.10 The primers for renin and ß-actin were used as described.11 The sequences of the primers used for the amplification of dynamin1, dynamin2, MINT, and nucleolin are available on request.
Plasmid Constructs
The 4.2-kb, 2.8-kb, and the deletion constructs of the 2.8-kb renin promoter fragment were obtained as described previously.11 The 3 TGAC sites from 2698 to 2695 bp, from 2674 to 2671 bp, and from 2657 to 2654 bp in the 2.8-kb fragment were deleted with the QuikChange site-directed mutagenesis kit (Stratagene).
Transient DNA Transfection
Transfection was performed using Fugene 6 transfection reagent (Roche Applied Science) essentially as described.11
Dual Luciferase Assay
Luciferase activity was measured with the Dual Luciferase Assay kit from Promega according to the manufacturers instructions. Light production was measured for 20 s for firefly luciferase and renilla luciferase activity in a Lumat LB 9507 luminometer (Berthold). The relative luciferase activity was calculated as luciferase/renilla luciferase.
Electrophoretic Mobility-Shift Assay
Nuclear protein extracts were obtained as described.11 The gel shift reaction (10 µL) was run as described.11 After electrophoresis at room temperature, the gels were dried for autoradiography.
Used Oligonucleotides
The following oligonucleotides were used: probe A, 5' ATCCTCCCAAATGACATCACTAACCACG 3'; mutated probe A, 5' ATCCTCCCAAAATTTATCACTAACCACG 3; probe B, 5' ACGCAGATGGTGACCTGGCTGTACTCT 3'; mutated probe B, 5'ACGCAGATGGATTTCTGGCTGTACTCT 3'; probe C, 5' GGCTGTACTCTGACCTCTGAGTGGCTG 3'; and mutated probe C, 5' GGCTGTACTCATTTCTCTGAGTGGCTG 3'.
Immunoblotting
Total protein extraction from As4.1 cells and Western blotting was performed as described.11 Antidynamin 1 antibody (ab14448) was purchased from Abcam.
Statistics
Data are expressed as mean±SE. To test homogeneity of variance, data were analyzed by Levenes test. Multiple comparisons of several groups were done by ANOVA followed by a Bonferroni reduction. P<0.05 was considered significant.
| Results |
|---|
|
|
|---|
|
|
Characterization of the Effect of Increased Intracellular Ca2+ Concentration on Renin Gene Expression
To exclude that the increase in the cytosolic calcium concentration evoked by thapsigargin may activate protein kinase C, and protein kinase C activity, in turn, was responsible for the downregulation of the renin mRNA abundance, we blocked protein kinase C activity. For this purpose, we used 1 µmol/L Gö6976, 1 µmol/L Gö6983, and 100 nmol/L calphostin, which are all well-established potent inhibitors of protein kinase C activity.1214 As4.1 cells, therefore, were incubated with the inhibitors alone and in combination with thapsigargin for 24 hours. The determination of renin mRNA abundance revealed that the downregulation of the renin mRNA expression by thapsigargin is not altered by any of the used inhibitors (Figure 2B). From this we conclude that thapsigargin could act on renin gene expression independent of protein kinase C activity.
Mechanism of Action of Increased Intracellular Ca2+ Concentration on Renin Gene Transcription
To additionally study downstream signaling pathways by which Ca2+ exerts its action on renin gene expression, we tested whether this effect may result from a decreased renin gene transcription. We, therefore, transfected As4.1 cells with mouse renin1c promoter luciferase gene constructs. It turned out that 100 nmol/L of thapsigargin reduced the activity of a 4.2-kb renin promoter fragment, as well as a 2.8-kb renin promoter fragment to &30% to 40% of the control value (data not shown). To narrow down the possible sequences mediating this effect of thapsigargin on renin gene promoter activity, different constructs of the 2.8-kb renin promoter fragment in which different deletions were set were tested for transcriptional activity. All of the constructs displayed similar basal transcriptional activity except that of construct 2.8kb
2651 to 2603 where a nearly complete lack of transcriptional activity was found. The effect of thapsigargin on renin promoter activity was blunted when the region from 2719 to 2651 and from 2651 to 2603 was deleted, indicating important regulatory sequences for Ca2+-mediated inhibition of renin gene transcription in the area from 2719 to 2603 (Figure 3).
|
This area is part of the enhancer region of the renin gene,4 and a great many potential transcription binding sites were described for this short DNA fragment. The CAMP responsive element (CRE) site from 2698 to 2691 (A) was found to play a crucial role in the downregulation of renin gene expression by tumor necrosis factor
.15 Therefore, we investigated whether this CRE site is also important for the downregulation of renin gene expression by thapsigargin. As shown in Figure 4, the deletion of the CRE site from 2698 to 2694 (A) alone had only a marginal effect on the inhibition of renin gene transcription by thapsigargin. As soon as 2 additional TAGC sites from 2674 to 2671 (B) and from 2657 to 2654 (C) were deleted, the regulatory effect of thapsigargin on renin gene transcription was missing, although the deletion per se had no inhibitory effect on renin gene transcription (Figure 4). Gel shift assays with nuclear extracts from As4.1 cells treated without (control) or with 100 nmol/L thapsigargin showed that every single of the 3 TGAC sites can bind nuclear proteins, but it also revealed that no changes in the DNA-protein complex, which is formed with each of the 3 TGAC sites, is independent of whether nuclear extracts were derived from control or thapsigargin-treated cells (Figure 5).
|
|
For the human renin promoter, it was speculated that ref-1, a calcium-regulated protein, is involved in the regulation of the renin gene transcription by endothelins.8 We, therefore, tested whether ref-1 is also involved in the downregulation of renin gene expression mediated by calcium. We also found that the ref-1 protein is expressed in the nucleus of As4.1 cells. Knockdown experiments with siRNA for ref-1 mRNA reduced ref-1 mRNA expression to 10% of cells transfected with the sense siRNA as a negative control but had no influence on the downregulation of renin mRNA by thapsigargin (data not shown).
Mechanism of Action of Increased Intracellular Ca2+ Concentration on Renin mRNA Stability
By blocking transcription in As4.1 cells with 2 µmol/L of actinomycin D or 20 µmol/L of
-amanitin, we determined that the renin mRNA half-life time was &10 hours (Figure 6). In contrast, in As4.1 cells, which were treated with 100 nmol/L of thapsigargin, we calculated a renin mRNA half-life time of &4 hours (Figure 6). Renin mRNA degradation in thapsigargin-treated cells is, therefore, &2.5 times faster than in untreated cells. From this finding, we concluded that thapsigargin also influences renin mRNA stability.
|
The involvement of many proteins, like dynamin nucleolin or MINT-homologous proteins, in the stabilization process of the human renin mRNA has been reported by several different groups.16,17 We investigated whether 1 of these proteins might be involved in the destabilization process of the murine renin mRNA mediated by thapsigargin. We found that the mRNA expression of dynamin-1 was time-dependently reduced by thapsigargin (Figure 7), whereas the mRNA expression of other proteins, possibly involved in the stabilization of renin mRNA, was not altered (data not shown). Additional studies revealed that a specific knockdown of the dynamin mRNA by siRNA also reduced dynamin-1 protein expression in As4.1 cells (Figure 8A). Because a specific knockdown of the dynamin-1 mRNA results in a reduced renin mRNA expression in As4.1 cells, it might be assumed that dynamin-1 is directly involved in the downregulation of renin gene expression via a destabilization of the renin mRNA (Figure 8B).
|
|
| Discussion |
|---|
|
|
|---|
3 transcription factor-binding sites.4 These responsible elements in the renin enhancer have already been described to play a crucial role for renin gene transcription.4 The site from 2698 to 2694 bp was found to bind the CREB/CREM transcription factor and to respond to forskolin treatment in juxtaglomerular cells.11,18 It was shown that the inhibition of renin gene transcription by tumor necrosis factor
is indirectly mediated via this CRE site.15 The sites from 2674 to 2671 bp and from 2657 to 2654 bp are described as TGACCT motifs, which are homologous to the steroid receptor-binding site. Retinoic acid receptors/retinoic X receptors have been identified as transcription factors binding to these 2 sites.19 In addition, also the nuclear orphan receptor EAR2 has been shown to bind to the TGACCT motif.20 Although retinoic acid is responsible for upregulation of renin gene expression, the EAR2 regulates the renin gene expression in As4.1 cells in a negative way.19,20 Li et al21 demonstrated that renin mRNA downregulation by vitamin D in As4.1 cells results from a decrease in the ren1c promoter activity. In addition, Shi et al19 demonstrated that the transcriptional activity of a construct containing a triple copy of a TGACCT-N10-TGACCT motif placed upstream of the renin promoter is repressed by 1.25 dihydroxyvitamin D3. A sequence highly homologous to the mouse renin enhancer has been found in the human renin promoter, which is located &11 kb upstream of the transcriptional start site and shares 71% identity with the mouse renin enhancer.4 From these findings, we suggest that our conclusions for the transcriptional regulation of the mouse renin transcription may also be relevant for the regulation of the human renin transcription. However, it has been suggested that the regulation of the human renin gene transcription by endothelins in choriodecidual cells is regulated via increasing the intracellular calcium concentration and thereby activating the ref-1 protein, which, in turn, inhibits renin gene transcription.8 We also found expression of the ref-1 protein in the mouse juxtaglomerular cells, but a knockdown of the ref-1 mRNA and the ref-1 protein had no effect on renin gene expression. In view of these data, we suggest that it is not likely that ref-1 is crucially involved in the calcium-mediated downregulation of the renin gene transcription in As4.1 cells. In addition to the regulation of the renin gene expression at the transcriptional level, we found that thapsigargin also downregulates renin gene expression by destabilization of the mRNA. The first evidence in support of an additional effect of thapsigargin on renin gene expression other than modulating renin gene transcription was the findings of a shortened half-life of renin mRNA in thapsigargin treated As4.1 cells (t1/2=4 hours) compared with controls (t1/2=10 hours). The involvement of a stabilization process in the regulation of the renin mRNA levels was already described some years ago for the cAMP-induced up regulation of the renin gene expression.17,22,23 In addition, some proteins have recently been identified binding to the renin mRNA and thereby playing an important role in the stabilization of the renin mRNA.16,24 For example, knockdown experiments for the protein HuR revealed that the half-life of human renin mRNA is decreased from 4.5 to 2.5 hours.25 However, in addition to stabilization proteins, proteins that destabilize human renin mRNA were also found. So, the knockdown of HABHB revealed an increased half-life of the human renin mRNA to &12 hours.25,26 In addition, for the human renin mRNA, a number of RNA-protein complexes were identified that increased when the cells were treated with forskolin, which, in turn, increases the intracellular cAMP concentration.5 In the mouse juxtaglomerular cell line, we found the expression of mRNAs for dynamin-1, for dynamin-2, and for MINT but not for nucleolin, all proteins that are considered members of the human renin mRNA-protein complex.2,5 Our findings also reveal that, among these proteins, dynamin-1 is selectively downregulated by thapsigargin. This finding could point toward a role for dynamin-1 in the destabilization process of the renin mRNA mediated by thapsigargin, and this assumption is confirmed by our finding that the knockdown of dynamin-1 mRNA by siRNA also results in an inhibition of renin gene expression.
Perspectives
Although it has been known for a long time that angiotensin II and endothelins inhibit renin gene expression in juxtaglomerular cells and that this decrease is accompanied by an increased protein kinase C activity and by an increase in intracellular calcium concentration,27 the additional intracellular pathways are still a matter of controversy. Our data show that the inhibition of renin gene expression by an increased cytosolic calcium concentration is a complex molecular process and results in a combined effect of destabilization of the renin mRNA and inhibition of renin gene transcription via transcription factor binding sites located in the renin enhancer. In additional studies, the proteins that are involved in this transcriptional repression of renin gene expression and how these proteins are regulated and altered by the cytosolic calcium concentration have to be discovered.
| Acknowledgments |
|---|
Received July 20, 2005; first decision August 8, 2005; accepted October 9, 2005.
| References |
|---|
|
|
|---|
2. Persson PB, Skalweit A, Mrowka R, Thiele BJ. Control of renin synthesis. Am J Physiol Regul Integr Comp Physiol. 2003; 285: R491R497.
3. Bader M, Ganten D. Regulation of renin: new evidence from cultured cells and genetically modified mice. J Mol Med. 2000; 78: 130139.[CrossRef][Medline] [Order article via Infotrieve]
4. Pan L, Gross KW. Transcriptional regulation of renin: an update. Hypertension. 2005; 45: 38.
5. Skalweit A, Doller A, Huth A, Kahne T, Persson PB, Thiele BJ. Posttranscriptional control of renin synthesis: Identification of proteins interacting with renin mRNA 3'-untranslated region. Circ Res. 2003; 92: 419427.
6. Ryan MJ, Black TA, Millard SL, Gross KW, Hajduczok G. Endothelin-1 increases calcium and attenuates renin gene expression in As4.1 cells. Am J Physiol Heart Circ Physiol. 2002; 283: H2458H2465.
7. Pan L, Jones CA, Glenn ST, Gross KW. Identification of a novel region in the proximal promoter of the mouse renin gene critical for expression. Am J Physiol Renal Physiol. 2004; 286: F1107F1115.
8. Fuchs S, Philippe J, Corvol P, Pinet F. Implication of Ref-1 in the repression of renin gene transcription by intracellular calcium. J Hypertens. 2003; 21: 327335.[CrossRef][Medline] [Order article via Infotrieve]
9. Sigmund CD, Okuyama K, Ingelfinger J, Jones CA, Mullins JJ, Kane C, Kim U, Wu CZ, Kenny L, Rustum Y. Isolation and characterization of renin-expressing cell lines from transgenic mice containing a renin-promoter viral oncogene fusion construct. J Biol Chem. 1990; 265: 1991619922.
10. Klar J, Vitzthum H, Kurtz A. Aldosterone enhances renin gene expression in juxtaglomerular cells. Am J Physiol Renal Physiol. 2004; 286: F349F355.
11. Klar J, Sandner P, Muller MW, Kurtz A. Cyclic AMP stimulates renin gene transcription in juxtaglomerular cells. Pflugers Arch. 2002; 444: 335344.[CrossRef][Medline] [Order article via Infotrieve]
12. Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Mueller HJ, Johannes FJ. Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS Lett. 1996; 392: 7780.[CrossRef][Medline] [Order article via Infotrieve]
13. Stempka L, Girod A, Muller HJ, Rincke G, Marks F, Gschwendt M, Bossemeyer D. Phosphorylation of protein kinase Cdelta (PKCdelta) at threonine 505 is not a prerequisite for enzymatic activity. Expression of rat PKCdelta and an alanine 505 mutant in bacteria in a functional form. J Biol Chem. 1997; 272: 68056811.
14. Jarvis WD, Turner AJ, Povirk LF, Traylor RS, Grant S. Induction of apoptotic DNA fragmentation and cell death in HL-60 human promyelocytic leukemia cells by pharmacological inhibitors of protein kinase C. Cancer Res. 1994; 54: 17071714.
15. Todorov VT, Volkl S, Muller M, Bohla A, Klar J, Kunz-Schughart LA, Hehlgans T, Kurtz A. Tumor necrosis factor-alpha activates NFkappaB to inhibit renin transcription by targeting cAMP-responsive element. J Biol Chem. 2004; 279: 14581467.
16. Morris BJ, Adams DJ, Beveridge DJ, van der WL, Mangs H, Leedman PJ. cAMP controls human renin mRNA stability via specific RNA-binding proteins. Acta Physiol Scand. 2004; 181: 369373.[CrossRef][Medline] [Order article via Infotrieve]
17. Chen M, Schnermann J, Smart AM, Brosius FC, Killen PD, Briggs JP. Cyclic AMP selectively increases renin mRNA stability in cultured juxtaglomerular granular cells. J Biol Chem. 1993; 268: 2413824144.
18. Pan L, Black TA, Shi Q, Jones CA, Petrovic N, Loudon J, Kane C, Sigmund CD, Gross KW. Critical roles of a cyclic AMP responsive element and an E-box in regulation of mouse renin gene expression. J Biol Chem. 2001; 276: 4553045538.
19. Shi Q, Gross KW, Sigmund CD. Retinoic acid-mediated activation of the mouse renin enhancer. J Biol Chem. 2001; 276: 35973603.
20. Liu X, Huang X, Sigmund CD. Identification of a nuclear orphan receptor (Ear2) as a negative regulator of renin gene transcription. Circ Res. 2003; 92: 10331040.
21. Li YC, Kong J, Wei M, Chen ZF, Liu SQ, Cao LP. 1,25-Dihydroxyvitamin D(3) is a negative endocrine regulator of the renin-angiotensin system. J Clin Invest. 2002; 110: 229238.[CrossRef][Medline] [Order article via Infotrieve]
22. Lang JA, Ying LH, Morris BJ, Sigmund CD. Transcriptional and posttranscriptional mechanisms regulate human renin gene expression in Calu-6 cells. Am J Physiol. 1996; 271: F94100.[Medline] [Order article via Infotrieve]
23. Sinn PL, Sigmund CD. Human renin mRNA stability is increased in response to cAMP in Calu-6 cells. Hypertension. 1999; 33: 900905.
24. Persson PB. Renin: origin, secretion and synthesis. J Physiol. 2003; 552: 667671.
25. Adams DJ, Beveridge DJ, van der WL, Mangs H, Leedman PJ, Morris BJ. HADHB, HuR, and CP1 bind to the distal 3'-untranslated region of human renin mRNA and differentially modulate renin expression. J Biol Chem. 2003; 278: 4489444903.
26. Fukamizu A, Watanabe M, Inoue Y, Kon Y, Shimada S, Shiota N, Sugiyama F, Murakami K. Cortical expression of the human angiotensinogen gene in the kidney of transgenic mice. Kidney Int. 1994; 46: 15331535.[Medline] [Order article via Infotrieve]
27. Kurtz A, Wagner C. Regulation of renin secretion by angiotensin II-AT1 receptors. J Am Soc Nephrol. 1999; 10: S162S168.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
E. S. Pentz, M. L. S. Sequeira Lopez, M. Cordaillat, and R. A. Gomez Identity of the renin cell is mediated by cAMP and chromatin remodeling: an in vitro model for studying cell recruitment and plasticity Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H699 - H707. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. T. Todorov, M. Desch, N. Schmitt-Nilson, A. Todorova, and A. Kurtz Peroxisome Proliferator-Activated Receptor-{gamma} Is Involved in the Control of Renin Gene Expression Hypertension, November 1, 2007; 50(5): 939 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wagner, C. de Wit, L. Kurtz, C. Grunberger, A. Kurtz, and F. Schweda Connexin40 Is Essential for the Pressure Control of Renin Synthesis and Secretion Circ. Res., March 2, 2007; 100(4): 556 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Itani, X. Liu, J. H. Pratt, and C. D. Sigmund Functional Characterization of Polymorphisms in the Kidney Enhancer of the Human Renin Gene Endocrinology, March 1, 2007; 148(3): 1424 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, Q. Shi, and C. D. Sigmund Interleukin-1{beta} Attenuates Renin Gene Expression Via a Mitogen-Activated Protein Kinase Kinase-Extracellular Signal-Regulated Kinase and Signal Transducer and Activator of Transcription 3-Dependent Mechanism in As4.1 Cells Endocrinology, December 1, 2006; 147(12): 6011 - 6018. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhoux, D. R. Davis, and C. D. Sigmund The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |