This Article Abstract Full Text (PDF) All Versions of this Article: 47/4/735    most recent 01.HYP.0000203160.80972.47v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andreasen, D. Articles by Hansen, P. B. Search for Related Content PubMed PubMed Citation Articles by Andreasen, D. Articles by Hansen, P. B. Related Collections Other Vascular biology

(Hypertension. 2006;47:735.)
© 2006 American Heart Association, Inc.

Original Articles

Coexpression of Voltage-Dependent Calcium Channels Ca_v1.2, 2.1a, and 2.1b in Vascular Myocytes

Ditte Andreasen; Ulla G. Friis; Torben R. Uhrenholt; Boye L. Jensen; Ole Skøtt; Pernille B. Hansen

From the Physiology and Pharmacology, University of Southern Denmark, Odense, Denmark.

Correspondence to Pernille B. Hansen, Department of Physiology and Pharmacology, University of Southern Denmark, Winsløwparken 21, 3, DK-5000, Odense C, Denmark. E-mail pbhansen{at}health.sdu.dk

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Voltage-dependent Ca²⁺ channels Ca_v1.2 (L type) and Ca_v2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca²⁺ currents. The expression of both Ca_v2.1a (P-type) and Ca_v2.1b (Q-type) mRNA was demonstrated by RT-PCR in renal preglomerular vessels from rats and mice. Immunolabeling was performed on A7r5 cells, renal cryosections, and freshly isolated renal VSMCs with anti-Ca_v1.2 and anti-Ca_v2.1 antibodies. Conventional and confocal microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6±3.9% of the voltage-dependent Ca²⁺ current, and blocking P-type currents (-agatoxin IVA 10 nmol/L) led to 20.2±3.0% inhibition, whereas 300 nmol/L of agatoxin IVA (blocking P/Q-type) inhibited 45.0±7.3%. In rat aortic smooth muscle cells (A7r5), blockade of L-type channels resulted in 28.5±6.1% inhibition, simultaneous blockade of L-type and P-type channels inhibited 58.0±11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7±5.6%) of the Ca²⁺ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca²⁺ channels in the rat and mouse.

Key Words: kidney • muscle, smooth • calcium

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Voltage-dependent Ca²⁺ influx in vascular smooth muscle cells (VSMCs) involves activation of high-voltage–activated (L-type) and in some cases low-voltage–activated (T-type), voltage-dependent Ca²⁺ channels (Ca_vs).¹ The distribution of Ca_v is segment specific: the smallest mesenteric arterioles express T-type Ca_v, whereas larger mesenteric arterioles express both L-type and T-type Ca_v.² Also, in renal preglomerular vasculature, the distribution of L-type and T-type Ca²⁺ channels may be heterogeneous.^3,4 In addition to L- and T-type channels, vascular smooth muscles from a number of sources express P/Q-type channels that have functional importance in renal afferent arterioles.⁵

P- and Q-type channels are splice variants of a single gene, Ca_V2.1 (Ca_V2.1a and Ca_V2.1b, respectively), and they are distinguished pharmacologically by their sensitivity to -agatoxin IVA. This difference in sensitivity is attributed to the insertion of 2 amino acids (Asp₁₆₀₅-Pro₁₆₀₆) in the extracellular IVS3-IVS4 linker of the Ca_V2.1b (Q-type) splice variant. A slower inactivation of the Q-type channel compared with the P-type has been ascribed to the insertion of 1 amino acid (Val₄₂₁) in the I-II linker region of Ca_V2.1b.⁶ It is not known whether both P and Q channels are expressed in native smooth muscle or whether they are coexpressed with each other and with L-type channels. Moreover, P- and Q-type Ca²⁺ currents have not been shown in native vascular smooth muscle despite the inhibitory effect of P/Q channel blockers on vascular contraction in the renal vascular bed.⁵

The main purpose of the present study was to determine whether VSMCs express both P- and Q-type channels, and if so, whether they contribute to Ca²⁺ currents. We used an RT-PCR–based strategy⁶ to distinguish between the splice variants Ca_V2.1a and Ca_V2.1b in renal resistance vessels. In addition, we modified the procedure of Loutzenhiser and Loutzenhiser⁷ for isolation of vascular smooth muscle from renal preglomerular vessels from rats to isolation of mouse smooth muscle cells. Single smooth muscle cells were subjected to whole cell patch clamp investigation, and distinct Ca²⁺ currents were identified based on the application of channel subtype–specific toxins. The coexpression of several subtypes of Ca_vs in single smooth muscle cells was validated by immunostaining and confocal microscopy.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
Animal care followed the guidelines of the National Institutes of Health, and permissions were obtained from the Danish Animal Experiments Inspectorate under the Danish Ministry of Justice. Male Sprague-Dawley rats and C57BL/6 mice had free access to rodent chow and tap water.

RT-PCR and Ribonuclease Protection Assay
Preglomerular vessels were dissected from rats and mice, and RNA was extracted as described previously.⁵ RNA aliquots from the rat kidney and kidney regions were from an experimental series used previously and characterized.⁸ RT-PCR was performed with an annealing temperature of 50°C in 32 cycles. The primers included: forward primer, Ca_V1.2: 5'ccaagaaccagcaccag'3, reverse: 5'cccacaacaatcaaggc, covering bases 4777 to 4994 (GenBank Accession No. NM009781 [mouse]); forward primer, Ca_V2.1: 5'gcccttcgagtgttcaac3', reverse, Ca_V2.1a: 5'ctcaggttgatgaagttattcc3', covering bases 4642 to 4826 (185 bp rat) and 4498 to 4682 (mouse); and Ca_V2.1b: 5'caggttgatgaagttattcgg3', covering bases 4642 to 4824+6 bp, 189 bp (GenBank accession no. M64373 for rat⁶ and NM007578 for mouse). The Ca_V2.1–Ca_V2.1a PCR product was cloned in plasmid pSP73, sequenced, and linearized as described.⁸ Subsequent in vitro transcription gave a radiolabeled antisense RNA probe discriminating between Ca_V2.1a and b. Thus, hybridization and subsequent RNase digestion would protect a 185-bp product for Ca_V2.1a (P type) and a 165-bp product for Ca_V2.1b (Q type). Ribonuclease protection was performed exactly as described previously.⁸

Cells
Preglomerular smooth muscle cells from mice were isolated using a protocol modified from Loutzenhiser and Loutzenhiser.⁷ C57BL/6 mice were anesthetized by ketamine (100 mg/kg) and xylazin (10 mg/kg), and the aorta was catheterized for perfusion of the kidneys. In vivo perfusion was performed with a 3.5% agarose solution (Sea prep, Cambrex) at 37°C. The kidneys were removed and chilled on ice to solidify the agarose. Cortical slices were incubated in isolation medium containing collagenase NB8, 0.5 g/L (Serva); trypsin inhibitor, 0.1 g/L (Sigma); dispase II, 0.35 g/L (Roche); and DNAse I, 1.8 mL/L (Roche), for 45 minutes at 37°C. Interlobular arteries and afferent arterioles were collected under a microscope and transferred to an enzyme solution containing trypsin inhibitor, 0.05 g/L; agarase, (Sigma); elastase, 13 U/mL (Worthington); protease, 1.5 g/L (Sigma); collagenase NB8, 1.5 g/L (Serva); and collagenase, CP, 1.5 g/L (Calbiochem), and incubated 15 minutes at room temperature. Single smooth muscle cells were dispersed mechanically and kept at 4°C until further use. The isolation medium had the following composition (mmol/L): NaCl, 103; KCl, 5.4; NaHCO₃, 4.0; NaH₂PO₄, 1.5; MgSO₄, 0.8; glucose, 5.1; Na-pyrovate, 0.9; isethionic acid, 30; HEPES, 5.6; and (in ml/L): MEM vitamin solution (Sigma M6895), 10; MEM essential amino acid solution (Sigma M5550), 20; and MEM nonessential amino acid solution (Sigma M7145), 10.

Rat A7r5 cells (American Type Culture Collection) were cultured according to the manufacturer’s instructions. Renal VSMCs from rats were isolated as described by Gordienko et al.³ Renal vessels (interlobar, arcuate, and interlobular arteries) were in physiological salt solution (PSS) (in mmol/L: 120 NaCl, 6 KCl, 12 glucose, 10 HEPES, 1.2 MgCl₂, and 2.5 CaCl₂) on ice; transferred to Ca²⁺-free PSS (CaCl₂ replaced by MgCl₂); cut into 1-mm pieces; incubated with 1 mg/mL bovine albumin fraction V (Sigma), collagenase type I (Sigma), and trypsin inhibitor type II-S (Sigma) and 0.8 U/mL elastase type I (Sigma) at 37°C for 40 minutes; rinsed in ice-cold Ca²⁺-free PSS; triturated with a modified, wide-bore Pasteur pipette; and 1/3 vol of PSS was added.

Immunohistochemistry
Cryosections (5 µm) from rat kidneys were permeabilized in methanol and blocked with 5% goat serum+1% BSA in Tween Tris buffer saline (TTBS). Primary antibody was rabbit anti-_1C⁴ or rabbit anti-_1A⁵ antibody (Alomone Labs, Jerusalem, Israel). Secondary antibody was horseradish peroxidase–conjugated goat anti-rabbit IgG (DAKO) and Alexa 488– or Alexa 568–conjugated goat anti-rabbit IgG (Molecular Probes), all diluted 1:1000 in TTBS. Horseradish peroxidase–labeled specimens were stained with diaminobenzidine (DAB)⁺ (DAKO) and counterstained with hematoxylin. Images were captured with an Olympus BX51 microscope equipped with an HBO fluorescence lamp, WIG and WIBA filters, and an Olympus DP50 digital camera (DP-Soft, Olympus).

Confocal Microscopy
The specimens were mounted on a Leica DM IRBE upright microscope equipped with x40/1.0 numerical aperture (n.a.) and x100/1.4 n.a. oil immersion lenses (Leica oil 58884, refractive index of oil extraordinary at 23°C=1.518, abbe number=46), Leica TCS 4D confocal attachments, and an air-cooled Argon/Krypton laser. Images were obtained using a 488-nm excitation wavelength and 510-nm long-pass filter, from an average of 4 line scans of 1-s duration.

Patch Clamp
Patch clamp on isolated preglomerular smooth muscle cells from mice and A7r5 cells in the whole-cell configuration was performed as described.⁵ Experiments were performed at room temperature and with a pipette solution at pH 7.38. Immediately after the whole-cell configuration was obtained, the cells were superfused with a solution that facilitated currents through Ca_v using Ba²⁺ as a charge carrier, and the I-V relationship was monitored by the response to 8 voltage steps of 10 mV (range, –40 to 30 mV) for 400 ms from a holding potential of –60 mV. Then a repetitive pulse was applied every 5 s (from –60 mV to 10 mV for 40 ms). After stabilization of the inwardly directed current, the cells were superfused with the same solution now containing calciseptine (20 nmol/L, L-type), -agatoxin IVA (10 nmol/L, P-type), or -agatoxin IVA (300 nmol/L, P- and Q-type; Alomone Laboratory).

Statistical Analysis
Data are presented as mean±SE. The significance of changes was calculated by paired t test with Bonferroni reduction for multiple comparisons. P<0.05 was considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
RT-PCR Analysis of Ca_V2.1a and Ca_V2.1b Splice Variants
To detect whether both Ca_V2.1 splice variants were expressed in rat VSMCs, a dual set of PCR primers was designed to distinguish between Ca_V2.1a (P-type) and Ca_V2.1b (Q-type) at the splice site. The 3'-end of the Ca_V2.1a primer covered the splice site such that amplification of the Ca_V2.1b splice variant was highly unlikely (Figure 1A). The 3'-end of the Ca_V2.1b primer was within the 6-bp insert, allowing amplification only of this variant. RT-PCR assays using these primers were run on RNA extracted from preglomerular renal vessels and with renal cortex as a positive control. Amplification yielded products for both splice variants (Figure 1B), and sequencing of these revealed 100% homology to the respective splice variant sequences. Whether the splicing of Ca_V2.1 is the same for rats and mice is uncertain but likely.⁹ When cDNA from mouse preglomerular vessels was subjected to PCR amplification products of the expected size were obtained for Ca_V1.2, Ca_V2.1a, and Ca_V2b (Figure 1C). No amplification was observed with water instead of cDNA or when reverse transcriptase was omitted in the RT-PCR, thus confirming the mRNA origin of the amplification products. Ribonuclease protection assay with a labeled riboprobe generated from the cloned PCR product yielded 2 distinct hybridization products with the expected molecular size when whole-kidney RNA was analyzed (Figure 1D). Thus, both P and Q splice variants are expressed in rat kidney. The lowest abundance of both Ca_V2.1a and Ca_V2.1b was found in the outer medulla, whereas cortex and inner medulla were comparable (Figure 1D). The glyceraldehyde-3-dehydrogenase mRNA level was not different between kidney regions on the same RNA samples.⁸

View larger version (37K): [in this window] [in a new window]   Figure 1. RT-PCR design and results. (A) Primer design. F indicates forward primer; r-a and r-b, reverse primer specific for the CaV2.1a and CaV2.1b splice variants, respectively; xxx, 137 bp; CaV2.1a PCR product, 185 bp; CaV2.1b PCR product, 189 bp. (B) RT-PCR amplification of cDNA from rat preglomerular vessels for CaV2.1 splice variants. (C) RT-PCR amplification of cDNA from mouse preglomerular vessels for CaV2.1 splice variants. Negative controls were -RT: omission of reverse transcriptase during reverse transcription; and H2O: water instead of cDNA in the PCR. Positive control was renal cortex. Molecular size marker is X174DNA/HaeIII fragments. (D) Autoradiographs displaying the result of RNase protection assays for CaV2.1 splice variants with total RNA from whole rat kidney 5, 10, 20, and 40 µg (top) and kidney regions (bottom) outer medulla (OM) and inner medulla (IM).

Immunolabeling of Kidney Sections and Single VSMC for Ca²⁺ Channels
Next, the distribution of L- and P/Q-type channels was examined along the microvasculature. To this end, we used rat kidney cryosections immunolabeled with either Ca_V1.2 or Ca_V2.1 antibody. Using DAB chromogen as a substrate for visualization, labeling was associated with the entire renal preglomerular vasculature. Figure 2A and 2B shows staining of cross-sectioned cortical radial arteries branching into afferent arterioles. In separate experiments, immunofluorescence microscopy was performed. This method gave a higher resolution than DAB staining, allowing for the distinction of individual smooth muscle cells. Serial sections revealed positive staining of the same glomerular arterioles for both Ca_V1.2 and Ca_V2.1 visualized with immunofluorescence (Figure 2C and 2D). Preglomerular arteries were positively labeled for both channels (Figure 2E and 2F). No gaps from unlabeled smooth muscle cells appeared in any of the arteries or arterioles. This result strongly indicates that both channel proteins are expressed in all of the preglomerular renal VSMCs. In the preparation of single VSMCs, vessel fragments were left with an intact layer of smooth muscle cells. In 1 such vessel labeled with anti-Ca_V1.2 antibody, all of the cells displayed fluorescence, and confocal imaging showed that labeling was associated with the plasma membranes (Figure 2G). The immunofluorescence signal for Ca_V2.1 was more evenly distributed within single smooth muscle and associated with all smooth muscle cells (Figure 2H). To additionally study subcellular localization, confocal microscopy was performed on individual cells. For Ca_V1.2 there was a higher density of the channel labeling associated with the cell membrane (Figure 2I). Ca_V2.1 showed a more diffuse labeling throughout the cytoplasm (Figure 2J). Both Ca_V1.2 and Ca_V2.1 immunoreactive protein was also found in A7r5 cells (data not shown).

View larger version (47K): [in this window] [in a new window]   Figure 2. Immunohistochemical and immunocytochemical labeling of renal vascular smooth muscle for CaV1.2 (L type) and CaV2.1 (P/Q type). Rat cryosections labeled for CaV1.2 (A) and CaV2.1 (B) exhibit labeling associated with afferent arterioles (bars: 50 µm). Serial cryosections of kidney display immunofluorescence for CaV1.2 (C) and CaV2.1 (D) in the same glomerular arterioles (bars=50 µm). Cryosections labeled for CaV1.2 and CaV2.1 show immunofluorescence associated with interlobular arteries (E and F, bars: 20 µm). Confocal image of rat preglomerular vessel labeled with anti-CaV1.2 antibody (G, bar: 25 µm). Confocal image of rat renal cryosection showing a large artery labeled with CaV2.1 antibody (H, bar: 50 µm). Confocal images of freshly isolated rat renal VSMCs labeled with CaV1.2 (I, bar: 20 µm) and CaV2.1 antibody (J, bar: 20 µm).

Patch/Clamp Experiments
A distinction between different Ca²⁺ channel subtypes at the functional level was obtained through patch-clamp experiments on freshly isolated mouse preglomerular myocytes (Figure 3A). The cells exhibited typical voltage-activated Ca²⁺ currents that displayed significant rundown after 5 to 6 minutes. All of the inhibitor experiments were, therefore, done before this time. A typical example of an I-V curve is shown in Figure 3B. The L-type specific blocker calciseptine (20 nmol/L) inhibited the inward current by 35.6±3.9% (n=4); -agatoxin IVA (10 nmol/L), which blocks P-type currents, inhibited the inward current by 20.2±3.0% (n=4); and, finally, 300 nmol/L -agatoxin IVA blocking both P- and Q-type currents inhibited the current by 45.0±7.3% (n=3; P<0.05, all, compared with basal; Figure 3C). The current density in preglomerular smooth muscle was 6.03± 0.60 pA/pF (SE, n=11). Voltage-activated Ca²⁺ currents were also found in the aortic smooth muscle cell line (A7r5) where rundown was observed after 6 to 8 minutes. When 20 nmol/L of calciseptine was used, the Ca²⁺ current was inhibited by 30.6±2.8% (n=5; Figure 4). The next question was whether the effect of the blockers was additive. Because of the fast rundown in mouse preglomerular smooth muscle cells, the following experiments were only performed in A7r5 cells. The current density in A7r5 cells was 1.3±0.2 pA/pF (n=22). Cells were superfused first in the absence of blockers, then with the addition of 20 nmol/L calciseptine. After current measurements with this blocker alone, the same cell was superfused with a mixture of 20 nmol/L calciseptine and 10 nmol/L -agatoxin IVA. Calciseptine alone inhibited Ca²⁺ current by 28.5±6.1% (as in the previous series), whereas the mixture resulted in an additional reduction of the current by 58.0±11.8% (n=5). Thus, the effects of inhibition of L- and P-type Ca²⁺ channels were additive. In a third series of patch/clamp experiments, cells were first superfused with the superfusion solution alone, then the mixture of 20 nmol/L calciseptine and 10 nmol/L -agatoxin IVA, which gave an inhibition corresponding to what had been determined previously (43.2%±2.8, n=5). Subsequently, the same cell was superfused with a mixture of 20 nmol/L calciseptine and 300 nmol/L -agatoxin IVA, which should block L-, P-, and Q-type currents. This procedure resulted in inhibition of 88.7±5.6% (n=5) of the Ca²⁺ current (P<0.05, all, compared with basal; Figure 4).

View larger version (26K): [in this window] [in a new window]   Figure 3. Effect of antagonists of voltage-dependent calcium channels on calcium currents recorded in mouse VSMCs isolated from preglomerular vessels. (A) Representative photograph of freshly isolated mouse preglomerular VSMC. (B) Steady-state I-V relationship. (C) A repetitive pulse was applied every 5 s (from –60 mV to 10 mV for 40 ms), and the inwardly directed current was measured before and after superfusion with calciseptine (20 nmol/L), -agatoxin IVA (10 nmol/L), or -agatoxin IVA (300 nmol/L). The upper traces show the effect of the calcium-channel inhibitors. (D) Histogram showing the inhibitory effects of the calcium-channel blockers. Calciseptine (20 nmol/L, n=4), -agatoxin IVA (10 nmol/L, n=4), and, finally, -agatoxin IVA (300 nmol/L, n=3). *P<0.05 vs 0 inhibition; P<0.05 vs other treatment. Data are mean±SE.

View larger version (13K): [in this window] [in a new window]   Figure 4. Effect of antagonists of voltage-dependent calcium channels on currents in rat aortic A7r5 cells. Calcium currents were compared with control after application of calciseptine (20 nmol/L) and subsequent application of calciseptine (20 nmol/L)+-agatoxin IVA (10 nmol/L) and after combined application of 20 nmol/L calciseptine+300 nmol/L -agatoxin IVA (n=5; *P<0.05). All data are mean±SE.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In the present study we provide novel evidence for the colocalization of P-type, Q-type, and L-type voltage-activated Ca²⁺ channels in VSMCs obtained from several sources (renal preglomerular resistance vessels and aorta) and from several species (rat and mouse). We used an RT-PCR–based strategy to show that mRNA for both Ca_V2.1a (P-type) and Ca_V2.1b (Q-type) splice variants are present in renal smooth muscle cells. Consistent with this, we demonstrated in an aortic smooth muscle cell line that there was an additive reduction of currents through Ca_v with the L-type–specific blocker calciseptine and the P/Q-type–specific blocker -agatoxin IVA. When using low concentrations (10 nmol/L) of -agatoxin IVA combined with calciseptine, a residual current remained. This Ca²⁺ current could be nearly abolished by raising the -agatoxin IVA concentration of the blocker mixture to 300 nmol/L, a concentration that also blocks Q-type currents. Furthermore, also in freshly isolated mouse renal smooth muscle cells, all 3 types of Ca²⁺ currents were found. Thus, our molecular and functional data demonstrate expression of P- and Q-type channels, as well as L-type channels in rat and mouse VSMCs. Also, antibodies against both Ca_V1.2 and Ca_V2.1 label all of the smooth muscle cells present in rat renal preglomerular vasculature, implying that these proteins are localized in the same cells.

The integrated role of several different Ca_V subtypes in the same smooth muscle cell remains to be resolved. We have observed previously that both L- and P/Q-type Ca²⁺ channels contribute to the depolarization-induced global rise of intracellular Ca²⁺ concentration in renal arterioles.^4,5 These results suggest that the Ca²⁺ currents found in the present article contribute to excitation contraction coupling in intact vessels. In neurons, distinct roles of different Ca_V subtypes in synapses are established. Thus, in the neuromuscular junctions of mouse urinary bladder, the release of acetylcholine is coupled primarily to N-type channels, whereas ATP release depends on P/Q-type channel activation (reviewed by Waterman¹⁰). The enteric inhibitory motor neurons in the mouse colon release NO and ATP. NO release is governed primarily by Ca²⁺-sensitive NO production, whereas ATP is released through Ca²⁺-sensitive vesicular exocytosis; these processes show a differential dependence on Ca_V subtypes.¹⁰ It is possible that a similar division of tasks between Ca_V subtypes exists in smooth muscle cells. The channels could be located in spatially separated areas of the cell membrane and/or coupled to separate intracellular targets, with a need for the activation of channels throughout the membrane to obtain the global rise in [Ca²⁺]_i needed for contraction; alternatively, generation of a global rise in [Ca²⁺]_i sufficient to induce force generation could require activation of a larger number of channels than is represented by just 1 channel type. In any event, the role of the Ca_V subtype variation is likely to be found primarily on the level of channel regulation. As to their functional role in excitation–contraction coupling, the distinguishing features of P/Q-type Ca²⁺ currents compared with L-type Ca²⁺ currents are their very slow and Ca²⁺-independent rate of inactivation, with Q-type channels having a slower inactivation rate than P-type channels, and the strong inhibitory modulation by G proteins. The latter feature is involved in hormonal regulation of channel properties.^11,12 Channel regulation by Ca²⁺ binding and phosphorylation also differs between L- and P/Q-type channels. Thus, the presence of P/Q-type currents in the cells could significantly expand the time for active Ca²⁺ influx and allow hormonal influence on vascular reactivity.

The sensitivity to calciseptine in the present study is higher than reported in some studies (eg, Reference ¹³). On the other hand, 20 nmol/L calciseptine inhibited a depolarization-induced increase in Ca_i²⁺ in glomerular arterioles,⁴ and Ca²⁺ currents and depolarization-induced contractions in smooth muscle preparations have been reported to be inhibited with IC₅₀ values in the range of 5 to 75 nmol/L.^14,15

Immunolabeling of A7r5 cells, freshly isolated renal VSMCs, and renal cryosections showed labeling of all of the preglomerular VSMCs regardless of whether anti-Ca_V1.2 or anti-Ca_V2.1 antibody was used, indicating that both channels were expressed in all of the cells. Similarly, our electrophysiological data showed Ca²⁺ currents in all of the renal smooth muscle cells. This result is at variance with the results of Gordienko et al,³ who reported that only 30% of isolated renal VSMCs contained L-type currents as measured by single-cell patch clamp.³ The reason for the discrepancy is not clear, but it could be of technical origin, because L-type Ca currents are vulnerable. As reported previously in rat renal myocytes,³ we found an exquisitely large Ca-current density also in the mouse preglomerular myocytes (6.03±0.60 pA/pF) compared with rat tail artery myocytes (1.4 to 1.8pA/pF)¹⁶ and rat A7r5 cells (1.3±0.2 pA/pF).

Confocal imaging performed on immunofluorescence-labeled single, freshly isolated renal VSMCs revealed that, although Ca_V1.2 staining was clearly strongest in the area of the plasma membrane, Ca_V2.1 staining was found diffusely throughout the cytoplasm. One explanation for this diffuse appearance of Ca_V2.1 labeling in the cytoplasm could be binding of the antibody to an unspecific, cytoplasmic epitope. However, lines of evidence counter this explanation. First, a BLAST search did not give any hits apart from rat and mouse Ca_V2.1, indicating that no other known proteins contain epitopes identical to the one recognized by the anti-Ca_V2.1 antibody. Second, only a single band of the expected size appears in Western blotting on aorta, A7r5 cells, and VSMCs.⁵ This would speak against the presence of unspecific epitopes in these cells. Third, in immunohistochemical labelings, Ca_V2.1 immunoreactivity was restricted to vascular and glomerular structures. Thus, the strong labeling of the cytoplasm of smooth muscle cells with Ca_V2.1 antibody suggests localization of Ca_V2.1 protein. Strong expression of a transmembrane protein, such as Ca_V2.1 in the cytoplasm, could have several explanations. The patch/clamp data indicate that >60% of the Ca²⁺ current in A7r5 cells is because of P- and Q-type channels; thus, this could be associated with a higher level of Ca_V2.1 than Ca_V1.2 production and a higher level of immunoreactive Ca_V2.1 protein being processed within the cell. In addition, the cells could hold intracellular stores of channels, ready to be translocated to the membrane, or Ca_V2.1 could be involved in signaling in intracellular membranes. In any case, the observation of significant intracellular localization of Ca_V2.1 warrants additional study. In conclusion, vascular myocytes coexpress L-type and both splice variants of the P/Q- type Ca_vs.

Perspectives
Dihydropyridine Ca²⁺ channel blockers differ in their selectivity toward L- and P/Q-type Ca²⁺ channels. Thus, amlodipine and cilnidipine inhibit both L- and P/Q-type Ca²⁺ channels, whereas nifedipine and nitrendipine are selective toward L-type channels.¹⁷ Consistent with this, amlodipine reduces renal vascular resistance in spontaneously hypertensive rats,¹⁸ whereas nifedepine has no effect.¹⁹ In humans, amlodipine is associated with glomerular hyperfiltration and adverse effects on albuminuria,²⁰ whereas nitrendipine has been associated with a reduction in proteinuria.²¹ Channel selectivity may, therefore, be a relevant parameter to consider when comparing effects of various Ca²⁺ channel blockers.

	Acknowledgments

 
This work was supported by grants from the Danish Medical Research Council (22-04-0457, 2204-0305, and 22-02-0210), the Novo Nordisk Foundation, The Danish Heart Foundation (03-1-2-26-22078, 04-4-2-14-22144, and 04-10-B151-A229-22200), The Carlsberg Foundation, and the Vilhelm Pedersen Foundation. We thank Anthony M. Carter for language revision and Mette Fredenslund, Kristoffer Rosenstand, and Gitte Dybmose for technical assistance.

Received November 1, 2005; first decision November 17, 2005; accepted January 2, 2006.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Jaggar JH, Porter VA, Lederer WJ, Nelson MT. Calcium sparks in smooth muscle. Am J Physiol Cell Physiol. 2000; 278: C235–C256.[Abstract/Free Full Text]
2. Gustafsson F, Andreasen D, Salomonsson M, Jensen BL, Holstein Rathlou N-H. Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca²⁺ channels. Am J Physiol Heart Circ Physiol. 2001; 280: H582–H590.[Abstract/Free Full Text]
3. Gordienko DV, Clausen C, Goligorsky MS. Ionic currents and endothelin signaling in smooth muscle cells from rat renal resistance arteries. Am J Physiol. 1994; 266: F325–F341.[Medline] [Order article via Infotrieve]
4. Hansen PB, Jensen BL, Andreasen D, Skott O. Differential expression of T- and L-Type voltage-dependent calcium channels in renal resistance vessels. Circ Res. 2001; 89: 630–638.[Abstract/Free Full Text]
5. Hansen PB, Jensen BL, Andreasen D, Friis UG, Skott O. Vascular smooth muscle cells express the (1A) subunit of a P-/Q- type voltage-dependent Ca(2+)channel, and it is functionally important in renal afferent arterioles. Circ Res. 2000; 87: 896–902.[Abstract/Free Full Text]
6. Bourinet E, Soong TW, Sutton K, Slaymaker S, Mathews E, Monteil A, Zamponi GW, Nargeot J, Snutch TP. Splicing of 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci. 1999; 2: 407–415.[CrossRef][Medline] [Order article via Infotrieve]
7. Loutzenhiser K, Loutzenhiser R. Angiotensin II-induced Ca(2+) influx in renal afferent and efferent arterioles: differing roles of voltage-gated and store-operated Ca(2+) entry. Circ Res. 2000; 87: 551–557.[Abstract/Free Full Text]
8. Andreasen D, Jensen BL, Hansen PB, Kwon TH, Nielsen S, Skott O. The (1G)-subunit of a voltage-dependent Ca(2+) channel is localized in rat distal nephron and collecting duct. Am J Physiol. 2000; 279: F997–F1005.
9. Jun K, Piedras-Renteria ES, Smith SM, Wheeler DB, Lee SB, Lee TG, Chin H, Adams ME, Scheller RH, Tsien RW, Shin HS. Ablation of P/Q-type Ca(2+) channel currents, altered synaptic transmission, and progressive ataxia in mice lacking the (1A)-subunit. Proc Natl Acad Sci U S A. 1999; 96: 15245–15250.[Abstract/Free Full Text]
10. Waterman SA. Voltage-gated calcium channels in autonomic neuroeffector transmission. Prog Neurobiol. 2000; 60: 181–210.[CrossRef][Medline] [Order article via Infotrieve]
11. Jones SW. Overview of voltage-dependent calcium channels. J Bioenerg Biomembr. 1998; 30: 299–312.[CrossRef][Medline] [Order article via Infotrieve]
12. Zamponi GW, Snutch TP. Modulation of voltage-dependent calcium channels by G proteins. Curr Opin Neurobiol. 1998; 8: 351–356.[CrossRef][Medline] [Order article via Infotrieve]
13. De Weille JR, Schweitz H, Maes P, Tartar A, Lazdunski M. Calciseptine, a peptide isolated from black mamba venom, is a specific blocker of the L-type calcium channel. Proc Natl Acad Sci U S A. 1991; 88: 2437–2440.[Abstract/Free Full Text]
14. Teramoto N, Ogata R, Okabe K, Kameyama A, Kameyama M, Watanabe TX, Kuriyama H, Kitamura K. Effects of calciseptine on unitary barium channel currents in guinea-pig portal vein. Pflugers Arch. 1996; 432: 462–470.[CrossRef][Medline] [Order article via Infotrieve]
15. Watanabe TX, Itahara Y, Kuroda H, Chen YN, Kimura T, Sakakibara S. Smooth muscle relaxing and hypotensive activities of synthetic calciseptine and the homologous snake venom peptide FS2. Jpn J Pharmacol. 1995; 68: 305–313.[Medline] [Order article via Infotrieve]
16. Fusi F, Saponara S, Gagov H, Sgaragli G. 2,5-Di-t-1,4-benzohydroquinone (BHQ) inhibits vascular L-type Ca²⁺ channel via superoxide anion generation. Br J Pharmacol. 2001; 133: 988–996.[CrossRef][Medline] [Order article via Infotrieve]
17. Furukawa T, Yamakawa T, Midera T, Sagawa T, Mori Y, Nukada T. Selectivities of dihydropyridine derivatives in blocking Ca(2+) channel subtypes expressed in Xenopus oocytes. J Pharmacol Exp Ther. 1999; 291: 464–473.[Abstract/Free Full Text]
18. Janssen BJ, Kam KL, Smits JF. Preferential renal and mesenteric vasodilation induced by barnidipine and amlodipine in spontaneously hypertensive rats. Naunyn Schmiedebergs Arch Pharmacol. 2001; 364: 414–421.[Medline] [Order article via Infotrieve]
19. Nievelstein HM, Van Essen H, Tijssen CM, Smits JF, Struyker Boudier HA. Systemic and regional hemodynamic actions of calcium entry blockers in conscious spontaneously hypertensive rats. Eur J Pharmacol. 1985; 113: 187–198.[Medline] [Order article via Infotrieve]
20. Delles C, Klingbeil AU, Schneider MP, Handrock R, Weidinger G, Schmieder RE. Direct comparison of the effects of valsartan and amlodipine on renal hemodynamics in human essential hypertension. Am J Hypertens. 2003; 16: 1030–1035.[CrossRef][Medline] [Order article via Infotrieve]
21. Voyaki SM, Staessen JA, Thijs L, Wang JG, Efstratopoulos AD, Birkenhager WH, de Leeuw PW, Leonetti G, Nachev C, Rodicio JL, Tuomilehto J, Fagard R. Systolic Hypertension in Europe (Syst-Eur) Trial Investigators. Follow-up of renal function in treated and untreated older patients with isolated systolic hypertension. Systolic Hypertension in Europe (Syst-Eur) Trial Investigators. J Hypertens. 2001; 19: 511–519.[CrossRef][Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				T. R. Uhrenholt, J. Schjerning, P. M. Vanhoutte, B. L. Jensen, and O. Skott Intercellular calcium signaling and nitric oxide feedback during constriction of rabbit renal afferent arterioles Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1124 - F1131. [Abstract] [Full Text] [PDF]

				K. Hayashi, S. Wakino, N. Sugano, Y. Ozawa, K. Homma, and T. Saruta Ca2+ Channel Subtypes and Pharmacology in the Kidney Circ. Res., February 16, 2007; 100(3): 342 - 353. [Abstract] [Full Text] [PDF]

				J. Zhang, R. Berra-Romani, M. J. Sinnegger-Brauns, J. Striessnig, M. P. Blaustein, and D. R. Matteson Role of Cav1.2 L-type Ca2+ channels in vascular tone: effects of nifedipine and Mg2+ Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H415 - H425. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 47/4/735    most recent 01.HYP.0000203160.80972.47v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andreasen, D. Articles by Hansen, P. B. Search for Related Content PubMed PubMed Citation Articles by Andreasen, D. Articles by Hansen, P. B. Related Collections Other Vascular biology