(Hypertension. 2006;48:286.)
© 2006 American Heart Association, Inc.
Original Articles |
From the Centre for Cardiovascular Science (A.J.B., N.F.K., F.G.-S., G.A.G., D.J.W., Y.V.K.), University of Edinburgh, Queens Medical Research Institute, Edinburgh, United Kingdom; Clinical Pharmacology Unit (A.P.D.), University of Cambridge, Centre for Clinical Investigation, Addenbrookes Hospital, Cambridge, United Kingdom; University of Texas Southwestern Medical Center at Dallas (M.Y.).
Correspondence to Alan Bagnall, Centre for Cardiovascular Science, University of Edinburgh, Queens Medical Research Institute, Little France Crescent, Edinburgh, EH16 4TJ United Kingdom. E-mail Alan.Bagnall{at}ed.ac.uk
| Abstract |
|---|
|
|
|---|
Key Words: endothelin mice endothelium receptors, endothelin vasodilation
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Cloning and Mapping of the Mouse ETB Receptor Gene
A 129/Ola mouse genomic DNA library was screened using an ETB cDNA probe, and a 17.7-kb genomic fragment (clone p
P) was cloned, partially sequenced, and mapped. Sequencing of exons 3, 4, 5, and 6 from p
P showed complete concordance with available published sequences of the ETB receptor cDNA.
Construction of Replacement Targeting Vector and Gene Targeting
The replacement vector was based on the LoxP2ROSA26 plasmid. A 956-bp region of p
P, spanning exons 3 and 4 of the ETB receptor gene, was amplified by PCR (oligo 1: TCCGGATCCAGAGGGTCATGACCCAC; oligo 2: TCACTAGTGATGGTTAACCTCACAG) and subcloned into the BamHI site of the vector, such that loxP sites flanked (floxed) the coding regions. A 3.8-kb loxP-flanked MC1: thymidine kinase:phosphoglucokinase:neomycin phosphotransferase (LTNL) selection cassette was then subcloned into the XbaI site 3' of the PCR product. The 3' homology arm consisted of the HpaI-SacI fragment of p
P (exon 5, intron 5, and 56 bp of exon 6), subcloned between the XbaI and NotI sites 3' of the selection marker, to produce the plasmid p
P26LTNL. The 5' homology arm was composed of an &11.9 kb XhoINaeI fragment of intron 2. This fragment was subcloned into p
P26LTNL upstream of the 5' loxP site. The completed construct, p
PW [Figure 1a (i)], thus featured a deletion of &1.1 kb from intron 2 between the Nae I site and a point 288 bp upstream of exon 3. p
PW was linearized by XhoI/NotI digestion and electroporated into E14Tg2a embryonic stem (ES) cells. G418-resistant clones were selected as described15 and DNA extracted for PCR analysis. Two positive controls were run for each DNA sample: oligo 3 (GCCTCTGTTCCACATACACTTCATTC) and oligo 4 (GTAGAAACTGAACAGCCACCAATC) amplified an &1.4-kb sequence from within the integrated replacement vector; oligo 5 (TTTGGGTGGTCTCTGTGGTTCTGG) and oligo 6 (GAACAGCTGCCACGTCTC) amplified an &2.4-kb sequence from the wild-type (W) allele; oligo 3 and oligo 6 amplified any specific integration event (&2.2 kb). Specific recombination at the 3' end was confirmed in HindIII-digested DNA with a 1.2-kb external probe complementary to intron 6/exon 7 (Figure 1a and 1b). Cells from targeted clones were electroporated with a Cre recombinase expression plasmid (pMC-Cre16) to remove the selection marker. Gancyclovir-resistant clones were analyzed by PCR. Oligo 5 and oligo 7 (AGCCATAAAGTCACAGCCATTC) amplified a 420-bp sequence spanning the 3' loxP site; oligo 8 (TCAGTTGTAATGAGACACAGAC) and oligo 9 (CTTAGAGCACAAAGACTCAGCAC) amplified a 500-bp sequence spanning the 5' loxP site. PCR products were sequenced to confirm loxP sequences. Targeted ES cell clones were injected into C57BL/6 blastocysts and transferred into C57BL/CBA foster mothers. Chimeras were bred to BKW females, and progeny genotyped by Southern blot of EcoR Idigested DNA using an internal probe [Figure 1a (iii)] and by PCR using oligos 7 and 8 (Figure 1a and 1c). These PCR oligos flanked an &1.1-kb sequence spanning both loxP sites in the targeted (flox) allele and a 2.2-kb sequence in the W allele.
|
Generation of EC-Specific ETB KO Mice
Homozygous (Flox/Flox) ETB mice (background: 50% 129/Ola and 50% BKW) were crossed with Tie2-Cre transgenic mice17 (C57BL/6/SJLF1 background). Because of previous reports18,19 of recombination events within germ cells of heterozygous floxed female mice featuring the Tie2-Cre transgene, the transgene was introduced through the male germ line only. Offspring from a single pair in which germ cell recombination was identified were deliberately intercrossed to assess whether a recombination event within the ETB gene was sufficient to prevent expression of functional ETB. Genotyping to identify flox, W, and recombined alleles was performed by Southern blot and PCR using oligos 7 and 8, as described earlier. The Tie2-Cre transgene was detected by PCR as described.17 All of the mice were given free access to tap water and standard (0.76% NaCl) mouse chow (Special Diet Services, United Kingdom) until implantation of telemeters or in vitro experiments. Mice were housed according to United Kingdom Home Office recommendations at 22°C with 12-hour diurnal light/dark cycles. All of the procedures were performed under the provisions of the Animals in Scientific Procedures Act (1986) and with the approval of local ethics committees.
Drugs and Solutions
ABT627 (ETA selective antagonist) and A192621 (ETB selective antagonist) were provided by Abbott Pharmaceuticals, United Kingdom. NW-nitro-L-arginine methyl ester hydrochloride (L-NAME), carbachol, acetylcholine (ACh), 2,2'-(hydroxynitrosohydrazono)bis-ethanimine (DETA-NO), and norepinephrine (NE) were supplied by Sigma Aldrich, Germany. Sarafotoxin 6c (S6c; ETB selective agonist) was purchased from Calbiochem.
[125I]-ET-1 Binding by Pulmonary EC
Lungs were removed and collagenase dispersed as described previously.20 Protein concentration was measured by the Bradford method,21 and an aliquot of cells equivalent to 50 µg/mL of membrane protein used for binding reactions. [125I]-ET-1 (7.4x104 TBq/mol; Amersham Biosciences, United Kingdom) in HEPES-Ringer/0.2% BSA buffer was added and the volume adjusted to 1 mL with additional buffer. ECs were precipitated with biotinylated Griffonia simplicifolia isolectin B4 (GSL I-B4; Vector Laboratories, United Kingdom)22 immobilized on streptavidin-coated magnetic beads (CELLection Biotin Binder kit, Dynal Ltd, United Kingdom; 107 beads/mL). Radioactivity was measured in a gamma counter and expressed as counts per minute per 50-µg membrane protein. Receptor-specific binding was calculated by subtracting binding in the presence of 3x107 M unlabeled ET-1, 3x107 M A192621, or 3x107 M ABT627 from total [125I]-ET-1 binding.
Plasma ET-1 Measurement
Under sodium pentobarbitone anesthesia, 1 mL of blood was withdrawn by direct cardiac puncture in 8- to 12-weekold male mice fed standard chow (0.76% NaCl) from weaning. Plasma ET-1 concentration was measured by radioimmunoassay23 according to the manufacturers instructions (Peninsula Laboratories Europe Ltd, United Kingdom).
In Vitro Measurement of Vascular and Tracheal Responses
Isometric contraction and relaxation was measured in 2-mm aortic and tracheal rings. Eight- to 10-weekold male mice were fed standard chow from weaning and culled by CO2 asphyxiation. Vessels were mounted in myograph chambers and incubated in physiological saline solution (PSS) at 37°C, constantly bubbled with 95%/5% O2/CO2. A tension of 1.5 g (7.36 mN) for aortic rings and 0.5 g (2.45 mN) for tracheal rings was applied and vessels equilibrated for 1 hour. Vessels were contracted 3 times with PSS+125 mmol/L potassium. For aortic rings, a further contraction with 3x107 M NE was followed by relaxation with 106 M ACh to assess viability of the endothelium. Vessels that failed to relax by >50% were rejected as evidence of endothelial damage during mounting. Concentration response curves (CRCs) were constructed for NE, NE+104 M L-NAME, ACh, ACh+107 M A192621, or vehicle (0.1% DMSO) and for DETA-NO. Vasodilatation was measured in aortas contracted with NE to 80% of the maximal NE-induced response (NE80) and relaxation expressed as percentage of NE80. Aortic relaxation to 107 M S6c was measured after 30 minutes of incubation with either 107 M A192621 or vehicle. For tracheas, CRCs were constructed for carbachol (108 M to 3x105 M; data not shown) and S6c after incubation with either 107 M A192621 or vehicle. All of the contractile responses were expressed as the percentage of final PSS+125 mmol/L of potassium-induced contraction.
Telemetry BP Recording
Male flox/flox Tie2-Cre and flox/flox litter mate control mice (12 to 16 weeks; 24 to 36g) were housed in single cages for 1 week before surgery and fed from weaning on standard mouse chow prepared as a gel to allow accurate measurement of intake. Under isoflurane anesthesia, a telemetry catheter was inserted into the left carotid artery and the transmitter device (Data Sciences) secured in the left flank as described previously.24 Mice continued standard gel chow for 7 days after surgery before commencement of high (7.6% NaCl+H2O ad libitum), medium (2.5% NaCl+1% saline ad libitum), or low (0.76% NaCl+H2O ad libitum) salt diets. A cohort of mice at the end of the study additionally received A192621 (30 mg/kg per day) in their gel. This dose has been shown previously to inhibit ETB-mediated hemodynamic responses in the rat.9,11 All of the dietary and drug treatments were maintained for 7 days. Systolic and diastolic BP and heart rate were recorded as described previously24 and analyzed using the Powerlab data acquisition system. All of the BP results represent the mean of values recorded over the final 24 hours of each dietary/drug intervention.
Effect of Age on Heart:Body Weight Ratio
Hearts were dissected from young mice (8 to 12 weeks old) and from older animals (52 to 60 weeks old) fed 0.76% NaCl diet from weaning. The ratio of total ventricular weight (TVW) in milligrams: body weight (BW) in grams was calculated.
Statistical Analysis
MAP data were compared by 1-way ANOVA with NewmanKeuls multiple comparison post test analysis. Pulmonary EC 125I ET-1 binding and TVW:BW ratio were compared using an unpaired Student t test. CRCs were constructed by linear regression analysis and compared by 2-way ANOVA. EC50 and EMax values, S6c-induced vasodilatation, and plasma ET-1 concentrations were each compared by 1-way ANOVA with Dunnetts multiple comparison post test analysis. Dose ratios were calculated as EC50 in the presence of antagonist divided by EC50 in the absence of antagonist. P values were accepted as statistically significant when <0.05. All of the analyses were performed using Graphpad Prism 3.0 software.
| Results |
|---|
|
|
|---|
Generation of Complete ETB KO (Piebald) Mice
We exploited the phenomenon of recombination events in germ cells of female flox/W Tie2-Cre mice to produce offspring homozygous for the recombined allele. Consistent with functional ETB deficiency, these mice exhibited white coat spotting (piebald appearance) because of the regional absence of neural crestderived melanocytes and died shortly after weaning from intestinal obstruction.25 In contrast to EC-specific KOs, both PCR and Southern analysis detected the recombined allele in piebalds.
ETB-Mediated ET-1 Binding Is Decreased in ECs of EC-Specific ETB KO Mice
ETB-mediated binding of [125I]-ET-1 in EC-enriched populations was decreased by 82% (P<0.001) in flox/flox Tie2-Cre pulmonary cells compared with W controls (Figure 2). ETA-mediated binding did not differ between groups.
|
ETB-Mediated Vasodilatation Is Impaired in EC-Specific ETB KO Mice
S6c (selective ETB agonist) produced vasodilatation of aortic rings in all genotypes (Figure 3a). The vasodilator response was significantly attenuated in flox/flox Tie2-Cre mice compared with W/W and single transgenic litter mates (P<0.05). Previous incubation with A192621 significantly inhibited S6c-induced vasodilatation in W/W and single transgenic mice (P<0.05 versus no antagonist).
|
ETB-Mediated Responses in Non-ECs Are Maintained in EC-Specific ETB KO Mice
No abnormality of gut development or pigmentation was observed, consistent with functional ETB expression on neuroblasts and melanoblasts, respectively. S6c-induced tracheal SMC contraction (Figure 3b) was unaltered in EC-specific ETB KO mice. In contrast, tracheas from piebald mice (complete ETB KO) demonstrated no contractile response to S6c. Previous incubation with A192621 significantly attenuated maximal S6c-induced contraction in W/W and flox/flox Tie2-Cre mice (P<0.0001 versus no antagonist).
Plasma ET-1 Concentration Is Increased in EC-Specific ETB KO Mice
Plasma ET-1 was significantly increased in flox/flox Tie2-Cre mice compared with controls, consistent with the proposed role of EC ETB as clearance receptors for ET-1 (Figure 4).
|
BP and Heart Rate Are Unaffected by EC-Specific ETB KO
Increasing dietary salt resulted in an increase in BP in both groups of mice (n=6 to 13). However, at no point during each salt treatment was there a difference in systolic, mean, or diastolic BP between control and EC-specific ETB KO mice. Treatment for 7 days with a selective pharmacological ETB antagonist during high-salt diet resulted in further increases in BP (flox/flox 159.7±4.0; P<0.05 versus 7.6% NaCl; n=7), although the increase just failed to reach statistical significance in flox/flox Tie2-Cre mice (154±2.9; P=0.06 versus 7.6% NaCl; n=6; Figure 5). Heart rate (&570 bpm) was not influenced by salt intake, genotype, or pharmacological ETB antagonism (data not shown).
|
Aged EC-Specific ETB KO Mice Do Not Develop Cardiac Hypertrophy on Normal Salt
TVW/BW ratio (mg/g) did not differ between control and EC-specific KO mice in either age group, consistent with the lack of BP difference observed during telemetric studies (young mice flox/flox 3.56±0.13, flox/flox Tie2-Cre 3.74±0.22; P=0.48; n=12 to 13; aged mice flox/flox 4.13±0.29, flox/flox Tie2-Cre 4.59±0.32; P=0.31; n=8 to 9).
Impaired ACh-Induced Vasodilatation in Aortas From EC-Specific ETB KO Mice and W Aortas Pretreated With ETB Antagonist
EC-specific ETB KO resulted in significantly impaired ACh-induced vasodilatation (Figure 6a). Previous incubation with A192621 impaired ACh-induced vasodilatation in W/W (P< 0.001) but not flox/flox Tie2-Cre rings. Loss of EC ETB did not influence vasodilatation in response to the endothelium-independent vasodilator DETA-NO (Figure 6b). To examine whether EC-specific ETB KO mice demonstrated decreased endogenous NO release, we studied vasoconstrictor responses to NE before and after exposure to L-NAME (Figure 6c and 6d). NE-induced contraction was significantly enhanced in both groups of mice (P<0.0001) after NO synthase inhibition. However, the magnitude of the increased contractile response after L-NAME was significantly greater in W than EC-specific KOs (dose ratio before/after L-NAME; W/W, 10.1; flox/flox Tie2-Cre, 2.5).
|
| Discussion |
|---|
|
|
|---|
We have demonstrated that loss of EC ETB does not influence BP, regardless of dietary salt intake. After a high-salt diet, rescued ETB-deficient rats8 and mice26 and ETB antagonisttreated rats9 develop grossly elevated BP compared with controls. We observed a clear relationship between salt intake and BP in our mice, with significant increases in BP observed when dietary NaCl intake exceeded &2.5%. Modest hypertension during salt loading has been described in several mouse strains, particularly those featuring 2 copies of the renin gene. The genetic background of our mice features DNA derived from 129/Ola strain (2 renin genes28) and C57BL/6, a single renin gene strain that can also develop increased BP after salt loading.24,29 Although the influence of salt in our genetic background may have obscured subtle changes in BP secondary to EC ETB KO, we still found that selective pharmacological antagonism of ETB during high-salt diet led to further increases in BP, as described previously in the rat.9 Although there was no difference in BP between control and KOs during pharmacological ETB blockade, the absolute increase in BP just failed to reach statistical significance in EC-specific KOs (P=0.06). The potential effects of EC ETB KO on a salt-resistant genetic background are, thus, intriguing and merit further study.
We report that loss of endogenous ETB activity, through either EC-specific ETB KO or acute exposure to ETB-selective antagonists, results in endothelial dysfunction, as assessed by ACh-induced vasodilatation. The lack of effect on vasodilatation of A192621 in EC-specific ETB KOs suggests that this is predominantly because of loss of EC ETB function and is likely related to decreased NO bioavailability, because relaxation to ACh is mainly mediated by NO in the mouse aorta.30,31 Diminished NO bioavailability may result from loss of endogenous EC ETB-mediated NO release, as suggested by the acute effect of pharmacological ETB inhibition in W vessels. In addition, the modest enhancement of NE-induced vasoconstriction after L-NAME indicates that vascular tone in EC-specific ETB KO mice is less dependent on endogenous NO release than in W mice. However, NO bioavailability may also be influenced indirectly by increased plasma ET-1. EC-specific overexpression of a prepro-ET-1 transgene increases reduced nicotinamide-adenine dinucleotide phosphate oxidase activity, superoxide production, and vascular remodeling but does not increase BP.32 In vitro studies33 suggest that the increase in reduced nicotinamide-adenine dinucleotide phosphate oxidase activity is ETA mediated and, hence, may be increased when plasma ET-1 levels are raised. However, whether superoxide contributes significantly to BP in models of exogenous34,35 or endogenous32,36 elevation of ET-1 remains controversial. Our experiments confirm the results of previous transgenic studies demonstrating that an isolated increase in plasma ET-1 does not result in hypertension in young mice.32,37,38 The magnitude of the increase in plasma ET-1 that we observed was similar to that in rescued ETB-deficient rats on a normal salt diet,8 suggesting that EC ETB is likely to be the predominant clearance receptor for ET-1.12 Although we have not analyzed prepro-ET-1 expression in EC-specific ETB KOs, we consider it unlikely that ET-1 production was increased, because EC ETB typically mediates autoinduction of prepro-ET-1 mRNA expression.39
Recent studies40 have identified that primary abnormalities of vascular smooth muscle cell tone in either peripheral resistance vessels or the renal vasculature may directly cause hypertension. This challenges the established hypothesis that primary abnormalities of renal sodium excretion are required for hypertension to develop.41 We have found that deletion of EC ETB from peripheral resistance vessels and from the renal vasculature does not alter BP, despite endothelial dysfunction and an increase in plasma ET-1 concentration. However, prolonged exposure to increased ET-1 may have caused downregulation or desensitization of ETA,42 decreasing both vascular tone and BP in EC ETB KO mice. We analyzed ETA expression by quantitative autoradiography43 and assessed functional responses to infusion of big ET-1 (1 to 10 nmol/kg) during anesthesia. ETA expression was unchanged in EC ETB KO mice, and the increase in BP observed after incremental doses of big ET-1 did not differ from that of control mice (data not shown). Thus, we consider it unlikely that downregulation or desensitization of vascular vasoconstrictor ETA activity obscured any hypertensive phenotype in EC ETB KO mice.
Two hypotheses may explain why EC-specific ETB KO mice, in contrast to mice with complete ETB deficiency, do not develop severe salt-sensitive hypertension. First, the ET-1/ETB signaling pathway regulating tubular reabsorption of sodium and water may be an autocrine process mediated solely by inner medullary CD cells27 and, as such, would be unaffected by loss of EC ETB. Alternatively, the effect of loss of any paracrine ET-1/ETB signaling pathway involving CD cells and medullary vasa recta EC13 that might normally regulate natriuresis by alteration of medullary blood flow11 may have been masked by changes in the glomerular filtration rate. Both ETA and ETB regulate afferent arteriolar vasoconstriction, whereas EC ETB produces vasodilatation of efferent arterioles.44 The balance between ET-1-mediated vasoconstriction and vasodilatation in the glomerulus may, thus, be important in determining tubular sodium delivery. Key targets for future studies will be to examine the effects of selective inner medullary CD ETB KO on sodium and water handling and to determine the influence of vascular ETB on glomerular function and medullary blood flow.
Perspectives
This article describes a novel murine model of ETB deficiency that permits investigation of the physiological influence of ETB expressed on a single cell type, without the confounding influence of loss of ETB from other cell types. This model will be useful for in vivo studies of ET-1/ETB physiology, particularly in organs such as the kidney, where tubular and vascular functions regulated by ET-1 are closely interlinked, making physiological studies using selective antagonists difficult to interpret.
| Acknowledgments |
|---|
phage library and genetic selection markers, Jan Ure for blastocyst injections, and Neil Johnston for plasma ET-1 measurement. Endothelin antagonists were a kind gift of Abbott Pharmaceuticals. Sources of Funding
A.J.B. was funded by a Wellcome Trust Clinical Research Fellowship (055891/Z/98/Z/DG/MH/fh). N.F.K. is a British Heart Foundation Junior Research Fellow (FS/03/006/15198). This work was supported by the Wellcome Trust Cardiovascular Research Initiative (grant 065901/Z/01/Z&A) and the British Heart Foundation (grant PG/06/031/20581). A.P.D. is supported by the British Heart Foundation.
Disclosures
None.
| Footnotes |
|---|
Received March 7, 2006; first decision March 23, 2006; accepted May 22, 2006.
| References |
|---|
|
|
|---|
2. Schiffrin EL. State-of-the-art lecture. Role of endothelin-1 in hypertension. Hypertension. 1999; 34: 876881.
3. Ahn D, Ge Y, Stricklett PK, Gill P, Taylor D, Hughes AK, Yanagisawa M, Miller L, Nelson RD, Kohan DE. Collecting duct-specific knockout of endothelin-1 causes hypertension and sodium retention. J Clin Invest. 2004; 114: 504511.[CrossRef][Medline] [Order article via Infotrieve]
4. Arai H, Hori S, Aramori I, Ohkubo H, Nakanishi S. Cloning and expression of a cDNA encoding an endothelin receptor. Nature. 1990; 370: 216218.
5. Nakamuta M, Takayanagi R, Sakai Y, Sakamoto S, Hagiwara H, Mizuno T, Saito Y, Hirose S, Yamamoto M, Nawata H. Cloning and sequence analysis of a cDNA encoding human non-selective type of endothelin receptor. Biochem Biophys Res Commun. 1991; 177: 3439.[CrossRef][Medline] [Order article via Infotrieve]
6. Sumner MJ, Cannon TR, Mundin JW, White DG, Watts IS. Endothelin ETA and ETB receptors mediate vascular smooth muscle contraction. Br J Pharmacol. 1992; 107: 858860.[Medline] [Order article via Infotrieve]
7. Takayanagi R, Kitazumi K, Takasaki C, Ohnaka K, Aimoto S, Tasaka K, Ohashi M, Nawata H. Presence of non-selective type of endothelin receptor on vascular endothelium and its linkage to vasodilation. FEBS Lett. 1991; 282: 103106.[CrossRef][Medline] [Order article via Infotrieve]
8. Gariepy CE, Ohuchi T, Williams SC, Richardson JA, Yanagisawa M. Salt-sensitive hypertension in endothelin-B receptor-deficient rats. J Clin Invest. 2000; 105: 925933.[Medline] [Order article via Infotrieve]
9. Pollock DM, Pollock JS. Evidence for endothelin involvement in the response to high salt. Am J Physiol Renal Physiol. 2001; 281: F144F150.
10. Hoffman A, Abassi ZA, Brodsky S, Ramadan R, Winaver J. Mechanisms of big endothelin-1-induced diuresis and natriuresis: role of ET(B) receptors. Hypertension. 2000; 35: 732739.
11. Vassileva I, Mountain C, Pollock DM. Functional role of ETB receptors in the renal medulla. Hypertension. 2003; 41: 13591363.
12. Fukuroda T, Fujikawa T, Ozaki S, Ishikawa K, Yano M, Nishikibe M. Clearance of circulating endothelin-1 by ETB receptors in rats. Biochem Biophys Res Commun. 1994; 199: 14611465.[CrossRef][Medline] [Order article via Infotrieve]
13. Kotelevtsev Y, Webb DJ. Endothelin as a natriuretic hormone: the case for a paracrine action mediated by nitric oxide. Cardiovasc Res. 2001; 51: 481488.
14. Bagnall A, Webb D, Kotelevtsev Y. A transgenic strategy for analysis of the function of the endothelin-B- receptor. J Cardiovasc Pharmacol. 2000; 36: S90S92.[CrossRef][Medline] [Order article via Infotrieve]
15. Clark AF, Sharp MG, Morley SD, Fleming S, Peters J, Mullins JJ. Renin-1 is essential for normal renal juxtaglomerular cell granulation and macula densa morphology. J Biol Chem. 1997; 272: 1818518190.
16. Araki K, Araki M, Miyazaki J, Vassalli P. Site-specific recombination of a transgene in fertilized eggs by transient expression of Cre recombinase. Proc Natl Acad Sci U S A. 1995; 92: 160164.
17. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001; 230: 230242.[CrossRef][Medline] [Order article via Infotrieve]
18. Constien R, Forde A, Liliensiek B, Grone HJ, Nawroth P, Hammerling G, Arnold B. Characterization of a novel EGFP reporter mouse to monitor Cre recombination as demonstrated by a Tie2 Cre mouse line. Genesis. 2001; 30: 3644.[CrossRef][Medline] [Order article via Infotrieve]
19. Koni PA, Joshi SK, Temann UA, Olson D, Burkly L, Flavell RA. Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med. 2001; 193: 741754.
20. Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A, Vecchi A. A general strategy for isolation of endothelial cells from murine tissues. Characterization of two endothelial cell lines from the murine lung and subcutaneous sponge implants. Arterioscler Thromb Vasc Biol. 1997; 17: 15991604.
21. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72: 248254.[CrossRef][Medline] [Order article via Infotrieve]
22. Laitinen L. Griffonia simplicifolia lectins bind specifically to endothelial cells and some epithelial cells in mouse tissues. Histochem J. 1987; 19: 225234.[CrossRef][Medline] [Order article via Infotrieve]
23. Rolinski B, Sadri I, Bogner J, Goebel FD. Determination of endothelin-1 immunoreactivity in plasma, cerebrospinal fluid and urine. Res Exp Med (Berl). 1994; 194: 924.[CrossRef][Medline] [Order article via Infotrieve]
24. Carlson SH, Wyss JM. Long-term telemetric recording of arterial pressure and heart rate in mice fed basal and high NaCl diets. Hypertension. 2000; 35: E1E5.[Medline] [Order article via Infotrieve]
25. Hosoda K, Hammer RE, Richardson JA, Baynash AG, Cheung JC, Giaid A, Yanagisawa M. Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat colour in mice. Cell. 1994; 79: 12671276.[CrossRef][Medline] [Order article via Infotrieve]
26. Quaschning T, Rebhan B, Wunderlich C, Wanner C, Richter CM, Pfab T, Bauer C, Kraemer-Guth A, Galle J, Yanagisawa M, Hocher B. Endothelin B receptor-deficient mice develop endothelial dysfunction independently of salt loading. J Hypertens. 2005; 23: 979985.[Medline] [Order article via Infotrieve]
27. Kohan DE. Endothelins: renal tubule synthesis and actions. Clin Exp Pharmacol Physiol. 1996; 23: 337344.[Medline] [Order article via Infotrieve]
28. Sharp MG, Fettes D, Brooker G, Clark AF, Peters J, Fleming S, Mullins JJ. Targeted inactivation of the Ren-2 gene in mice. Hypertension. 1996; 28: 11261131.
29. Gros R, Van Wert R, You X, Thorin E, Husain M. Effects of age, gender, and blood pressure on myogenic responses of mesenteric arteries from C57BL/6 mice. Am J Physiol Heart Circ Physiol. 2002; 282: H380H388.
30. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA, Fishman MC. Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature. 1995; 377: 239242.[CrossRef][Medline] [Order article via Infotrieve]
31. Lake-Bruse KD, Faraci FM, Shesely EG, Maeda N, Sigmund CD, Heistad DD. Gene transfer of endothelial nitric oxide synthase (eNOS) in eNOS-deficient mice. Am J Physiol. 1999; 277: H770H776.[Medline] [Order article via Infotrieve]
32. Amiri F, Virdis A, Neves MF, Iglarz M, Seidah NG, Touyz RM, Reudelhuber TL, Schiffrin EL. Endothelium-restricted overexpression of human endothelin-1 causes vascular remodeling and endothelial dysfunction. Circulation. 2004; 110: 22332240.
33. Li L, Fink GD, Watts SW, Northcott CA, Galligan JJ, Pagano PJ, Chen AF. Endothelin-1 increases vascular superoxide via endothelin(A)-NADPH oxidase pathway in low-renin hypertension. Circulation. 2003; 107: 10531058.
34. Sedeek MH, Llinas MT, Drummond H, Fortepiani L, Abram SR, Alexander BT, Reckelhoff JF, Granger JP. Role of reactive oxygen species in endothelin-induced hypertension. Hypertension. 2003; 42: 806810.
35. Elmarakby AA, Loomis ED, Pollock JS, Pollock DM. NADPH oxidase inhibition attenuates oxidative stress but not hypertension produced by chronic ET-1. Hypertension. 2005; 45: 283287.
36. Williams JM, Pollock JS, Pollock DM. Arterial pressure response to the antioxidant tempol and ETB receptor blockade in rats on a high-salt diet. Hypertension. 2004; 44: 770775.
37. Hocher B, Thone-Reineke C, Rohmeiss P, Schmager F, Slowinski T, Burst V, Siegmund F, Quertermous T, Bauer C, Neumayer HH, Schleuning WD, Theuring F. Endothelin-1 transgenic mice develop glomerulosclerosis, interstitial fibrosis, and renal cysts but not hypertension. J Clin Invest. 1997; 99: 13801389.[Medline] [Order article via Infotrieve]
38. Shindo T, Kurihara H, Maemura K, Kurihara Y, Ueda O, Suzuki H, Kuwaki T, Ju KH, Wang Y, Ebihara A, Nishimatsu H, Moriyama N, Fukuda M, Akimoto Y, Hirano H, Morita H, Kumada M, Yazaki Y, Nagai R, Kimura K. Renal damage and salt-dependent hypertension in aged transgenic mice overexpressing endothelin-1. J Mol Med. 2002; 80: 105116.[CrossRef][Medline] [Order article via Infotrieve]
39. Saito S, Hirata Y, Imai T, Marumo F. Autocrine regulation of the endothelin-1 gene in rat endothelial cells. J Cardiovasc Pharmacol. 1995; 26 (suppl 3): S84S87.[Medline] [Order article via Infotrieve]
40. Crowley SD, Gurley SB, Oliverio MI, Pazmino AK, Griffiths R, Flannery PJ, Spurney RF, Kim HS, Smithies O, Le TH, Coffman TM. Distinct roles for the kidney and systemic tissues in blood pressure regulation by the renin-angiotensin system. J Clin Invest. 2005; 115: 10921099.[CrossRef][Medline] [Order article via Infotrieve]
41. Guyton AC. Blood pressure control - special role of the kidneys and body fluids. Science. 1991; 252: 18131816.
42. Telemaque-Potts S, Kuc RE, Maguire JJ, Ohlstein E, Yanagisawa M, Davenport AP. Elevated systemic levels of endothelin-1 and blood pressure correlate with blunted constrictor responses and downregulation of endothelin(A), but not endothelin(B), receptors in an animal model of hypertension. Clin Sci (Lond). 2002; 103 (suppl 48): 357S362S.[Medline] [Order article via Infotrieve]
43. Davenport AP, Kuc RE. Radioligand binding assays and quantitative autoradiography of endothelin receptors. Methods Mol Biol. 2002; 206: 4570.[Medline] [Order article via Infotrieve]
44. Inscho EW, Imig JD, Cook AK, Pollock DM. ETA and ETB receptors differentially modulate afferent and efferent arteriolar responses to endothelin. Br J Pharmacol. 2005; 146: 10191026.[CrossRef][Medline] [Order article via Infotrieve]
Related Article:
Hypertension 2006 48: 211-212.
This article has been cited by other articles:
![]() |
Y. Ge, A. Bagnall, P. K. Stricklett, D. Webb, Y. Kotelevtsev, and D. E. Kohan Combined knockout of collecting duct endothelin A and B receptors causes hypertension and sodium retention Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1635 - F1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. de Lange, C. M. Halabi, A. M. Beyer, and C. D. Sigmund Germ line activation of the Tie2 and SMMHC promoters causes noncell-specific deletion of floxed alleles Physiol Genomics, September 17, 2008; 35(1): 1 - 4. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dhaun, J. Goddard, D. E. Kohan, D. M. Pollock, E. L. Schiffrin, and D. J. Webb Role of Endothelin-1 in Clinical Hypertension: 20 Years On Hypertension, September 1, 2008; 52(3): 452 - 459. [Full Text] [PDF] |
||||
![]() |
G. Fink, M. Li, Y. Lau, J. Osborn, and S. Watts Chronic Activation of Endothelin B Receptors: New Model of Experimental Hypertension Hypertension, September 1, 2007; 50(3): 512 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Pollock and M. P. Schneider Clarifying Endothelin Type B Receptor Function Hypertension, August 1, 2006; 48(2): 211 - 212. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |