(Hypertension. 2006;48:587.)
© 2006 American Heart Association, Inc.
Original Articles |
From the Institut de Physiologie et Biologie Cellulaires, Centre National de la Recherche Scientifique Unité Mixte de Recherche, Université de Poitiers, Poitiers, France.
Correspondence to Romain Guinamard, Centre National de la Recherche Scientifique Unité mixte de recherche 6187, Université de Poitiers, 40 av du Recteur Pineau, 86022 Poitiers Cedex, France. E-mail romain.guinamard{at}univ-poitiers.fr
| Abstract |
|---|
|
|
|---|
Key Words: hypertrophy cation channel ventricular function
| Introduction |
|---|
|
|
|---|
The spontaneously hypertensive rat (SHR) is a well-established genetic model of hypertension and cardiac hypertrophy when compared with its normotensive equivalent, the Wistar-Kyoto rat (WKY). The chronic hypertrophy gives rise to heart failure. Thus, because cardiac hypertrophy in humans is often associated with chronic hypertension, the SHR is a realistic model of human hypertrophy.1 Structural characteristics of hypertrophy have been detected in whole SHR heart and in single myocytes from the left ventricle.2,3 During the compensated stage (from 3 months of age), an increase in myocyte contractility, amplitude of the intracellular Ca2+ transient, and action potential duration (APD) have been observed, with no changes in resting membrane potential.4,5 The APD prolongation is correlated with a prolonged QT interval on the ECG6 and is mainly attributable to a reduction of the transient outward current (Ito) density.7 Moreover, SHR ventricular myocytes exhibit an inward current having the same properties of the pacemaker current If8,9 that would favor the appearance of ventricular arrhythmias.
In addition to the above-mentioned changes, Ruocco et al10 reported a higher incidence of delayed-after-depolarizations (DADs) and associated-after-contractions in SHR ventricular myocytes compared with WKY rats. DADs are generated by intracellular Ca2+ waves caused by a spontaneous and local Ca2+ release from intracellular stores. In accordance with this mechanism, the incidence of cells presenting calcium waves is greater in cardiomyocytes isolated from SHR.11 Thus, any modification of Ca2+-activated currents could participate in these DADs. Interestingly, we observed previously a [Ca2+]i-activated nonselective cation channel (NSCCa) in normotensive rat ventricular myocytes in primary culture; these cells undergo a dedifferentiating process with properties similar to that which occurs in hypertrophied cells.12,13 Channel detection was found to increase with degree of dedifferentiation. The channel shares electrophysiological properties with the TRPM4 channel protein.1417
The purpose of the present experiments was to determine the incidence of such an NSCCa channel in left ventricular myocytes from SHRs in comparison with normotensive WKY rats. We report that the functional current is more detected in hypertrophied myocytes from SHR, as also is TRPM4 mRNA.
| Methods |
|---|
|
|
|---|
Solutions and Chemicals
For cell dissociation, the Tyrode solution contained (in mM): 140 NaCl; 5.4 KCl; 1.8 MgCl2; 1.8 CaCl2; 10 glucose; and 10 HEPES; pH was adjusted to 7.35 with NaOH.
For patch clamp experiments, the standard 140 mmol/L NaCl solution for bath and pipette contained (in mM): 140 NaCl; 4.8 KCl; 1.2 MgCl2; 10 glucose; and 10 HEPES. Pipette and bath solutions contained 1 mmol/L and 1.8 mmol/L of CaCl2, respectively. When specified, [Ca2+]i <10 µmol/L was determined with a combination of CaCl2 and Ca-EGTA buffers or addition of EGTA.19 Low NaCl solutions contained 14 or 42 mmol/L of NaCl (no KCl included) and were supplemented with sucrose to maintain osmolarity. To test monovalent cation selectivity, 140 mmol/L of NaCl were replaced by KCl. Ca2+ permeability was determined using a solution containing (in mM): 100 CaCl2; 10 glucose; and 10 HEPES. External solutions (pipette and bath) were adjusted to pH 7.4 with NaOH. The pH of perfused solutions was adjusted to 7.2. The effect of internal ATP was tested using a solution containing (in mM): 0.5 ATP, 1 CaCl2, and 1.2 MgCl2, corresponding with 0.04 free-ATP, as calculated with MaxChelator (www.stanford.edu/
cpatton/maxc.html).
Before patch sealing, cells were incubated for
10 minutes in a solution containing either 140 mmol/L of NaCl for control or 100 µmol/L of adenosine 5'-0 to 3-thiotriphosphate (ATP
S) added in the presence or absence of 1 µmol/L of Calphostin C or in the presence of 500 nM phorbol 12-myristate 13-acetate (PMA). Calphostin C, PMA, and glibenclamide were dissolved in DMSO to a maximal final DMSO ratio of 0.1% that had no effect on channel activity. Chemicals were from Sigma.
Cell Surface and Capacitance Measurements
Cells were examined by transmitted light imaging with a x10 phase contrast objective (Olympus X70). Images were analyzed using Lasersharp 3.2 software (Bio-Rad). The apparent cell surface area was estimated from measurements made on 100 cells. Cell capacitance was estimated in whole-cell patch clamp experiments from the capacitive transient elicited by a 10-mV depolarizing step from a holding potential of 80 mV and fitted to a single exponential.
ECGs
ECGs were recorded using the power laboratory 4/20 interface (ADInstruments) and chart5 software (ADInstruments) from anesthetized animals. QT and RR durations were measured manually by evaluating the QT duration as the time elapsed between the onset of the Q wave and the end of the QT complex. Calculations were made from the average of 10 RR and QT complexes. Considering QT variations related to frequency, the QT was corrected according to the equation QTc=QT/(RRx100)1/2 suitable for small animals (QT and RR in milliseconds).20
Patch-Clamp Measurements
Single-channel currents were recorded from membrane patches of isolated cardiomyocytes held under voltage clamp with a RK400 (Biologic) patch-clamp amplifier, using the inside-out configuration of the patch-clamp technique.21 The bath reference was 0.5 mol/L KCl (in a 4% agar bridge) connected to an Ag/AgCl pellet. Liquid junction potentials arising from changes in bath solutions at the inner surface of the membrane patch were determined using a pipette containing 2.7 mol/L KCl. Applied potentials (Vm=VbathVpipette) were corrected accordingly. Experiments were conducted at room temperature (20°C to 25°C).
Data Analysis
Signals were analyzed with Bio-patch software (version 3.30; Biologic). Amplitude histograms were generated to construct I/V curves and estimate open probability (Po). Relative permeabilities and associated reversal potentials for current flow (Vrev) were estimated by fitting experimental measurements to the GoldmanHodgkin-Katz equation.22 Po as a function of voltage was fitted using a Boltzmann function: Po=Pmax+(PminPmax)/[1+exp(VV0.5)/s], where Pmin and Pmax represent the minimum and maximum open probabilities, respectively, V0.5 is the potential for half maximal activation, and s is the slope parameter. Experimental results are reported as mean±SEM. A paired Student t test was applied when Po was determined under different conditions on the same cell. Statistical significance was accepted for values of P<0.05. A Fishers exact test was used to compare the percentage of patches with channel activity under different conditions.
RT-PCR Analysis
Left ventricular and atrial samples were collected from WKY rats and SHRs. Total RNA was extracted by the Chomczynski method, using the RNABle reagent (Eurobio). cDNA was synthesized using the Pd(N)6 random hexamer primer (Amersham). Ten microliters of RNA, 2.4 µg of random primers, 11.3 mmol/L of DTT (Gibco), and 1.1 mmol/L of dNTPs (Invitrogen) were mixed in a total volume of 22 µL and incubated for 2 minutes at 65°C. Then, 30 U of RNAguard (Amersham) and 44 U of reverse transcriptase M-murine leukemia virus (Invitrogen) were added and incubated for 1 hour at 37°C, in a final volume of 50 mL. Primers for amplification were TTGGCATACTGGGAGACGCA and GGCCCAAGATCGTCATCGT for TRPM4, GGAGAGAGACTTGCCTGACC and CTGCGACCACAGGTTTTGAGA for TRPM5, and CACTCCTCCATTTTTCGGTG and AATTGAAGGCCGAGTCACAG for 18S RNA. The PCR amplification was carried out with 0.5 to 1 µg of cDNA, 0.25 mmol/L of dNTPs (Invitrogen), 0.4 µmol/L of each primer, 2 mmol/L of MgCl2, 1.25 U of Taq polymerase (Gibco), and 1X Taq buffer (Gibco) in a total volume of 25 µL. Thermal cycles performed in a PTC-100 (M.J. Research, Inc) were: 95°C for 3 minutes, followed by 30 cycles at 59°C for 30 s, 72°C for 30 s, and 95°C for 30 s. Amplification was stopped by a step at 59°C for 2 minutes and at 72°C for 10 minutes. Amplified products were electrophoresed on 1% agarose gels and stained with ethidium bromide. They were then sequenced using the ABI prism Big Dye terminator method (Applied Biosystems, Perkin-Elmer). Optical density ratios were determined using the Photoshop software by comparing density for TRPM4 to 18S RNA.
| Results |
|---|
|
|
|---|
|
Electrocardiograms from SHRs and WKY rats were performed (Figure 1E). The QT interval corrected value QTc was significantly increased by 21.7% in SHR compared with WKY animals (Figure 1E). This indicates that the SHR used here developed classical electrophysiological perturbations associated with ventricular APD prolongation.
Channel Properties in SHRs
We reported previously the expression of a 25 pS NSCCa channel in WKY rat ventricular myocytes in culture that undergo a dedifferentiating process with properties similar to hypertrophied cells.12 Here we investigated its functional expression in cardiomyocytes isolated from the SHR left ventricle.
Channel activity was recorded in the inside-out patch configuration, using 140 mmol/L NaCl standard solution on both sides of the membrane ([CaCl2]i=1.8 mmol/L; [CaCl2]o=1 mmol/L), called control condition. Single channel currents were detected in some patches. Figure 2A illustrates typical channel activity. The corresponding current-voltage relationship (Figure 2B) was linear with a slope conductance of 25±0.6 pS (n=4) and a reversal potential (Vrev) estimated to be 0.1±2.5 mV. Po values determined for various membrane potentials increased with depolarization (Figure 2C). Data were fitted to a Boltzmann function with the parameters 0.98±0.02 for Pmax, 19.3±2.7 mV for s, and +27.8±2.7 mV for V0.5 (n=4).
|
Ion selectivity was assessed by ion substitution experiments (see Table). When a patch was exposed to 140 mmol/L of NaCl in the pipette (extracellular side) and 42 or 14 mmol/L NaCl in the bath (intracellular side), the current-voltage relationship shifted toward the positive voltage range (Figure 2D) indicating a cationic selectivity. Replacement of NaCl (140 mmol/L) in the bath solution by KCl (140 mmol/L) did not significantly affect channel conductance or Vrev, indicating that the channel does not discriminate K+ over Na+. When the cytoplasmic side was bathed in a 100 mmol/L CaCl2 solution, Vrev=43.3±6.7 mV (n=4), corresponding with a PCa/PNa of 0.12. Thus, the channel conducts the monovalent Na+ and K+ ions but does not conduct or only weakly conducts the Ca2+ ion.
|
Channel Regulation in SHRs
As has been reported for several tissues23 in addition to human and rat cardiomyocytes,12,22 the nonselective cation channel in SHR myocytes is also dependent on [Ca2+]i and internal ATP. The Po of active channels at +40 mV is plotted in Figure 2E as a function of [Ca2+]bath, rising from 1 nmol/L to 1 mmol/L (n=4). Channel openings were seen at [Ca2+]i
0.1 µmol/L. Fitting of the Hill equation (see Figure 2 legend) to the experimental data points yielded an apparent dissociation constant (Kd) of 10±5.4 µmol/L and a Hill coefficient of 0.6±0.1.
Addition of 5.104 M ATP (corresponding with 40 µmol/L free-ATP) to the cytoplasmic side reversibly decreased Po to 22±8% of control (Figure 3B; Vm=+40 mV; n=6). The effect caused by ATP could be indicative of a sulfonylurea sensitivity, in a manner analogous to the nonselective cation channel from native reactive astrocytes24 or human atrial cardiomyocytes.22 On this basis, we assessed the effect of the sulfonylurea glibenclamide, a hypoglycemic agent, on SHR cardiomyocytes. Figure 3A and 3B illustrates the reversible action of 10 µmol/L of glibenclamide on channel activity. The drug reduced channel activity to 22.7±12.5% of that of control (Vm=+40 mV; n=4).
|
Flufenamic acid, a nonsteroidal anti-inflammatory drug, blocks nonselective cation channels12,22,25 and is a useful agent for distinguishing between TRPM4 and TRPM5 currents.17 Figure 3C illustrates the reversible action of this compound on channel activity. Channel inhibition was complete at 100 µmol/L. The dose-response curve for flufenamic acid is shown in Figure 3D, where the activity as a percentage of the control is plotted against the blocker concentration. Half-maximal inhibition by flufenamic acid was achieved at 5.5±1.7 µmol/L.
As reported previously for nonselective cation channels characterized from cardiac12,22 and cerebral artery smooth muscle cells,26 channel detection was increased significantly after stimulation of the protein kinase C (PKC) pathway. In myocytes dissociated from SHR hearts, channel activity was rarely detected after preincubation of the myocytes in the control 140 NaCl external solution (4 of 33 cells). However, when cells are incubated for
10 minutes, before establishment of the patch, in the presence of the ATP analogue ATP
S (100 µmol/L), a purinergic receptor agonist activating the phospholipase C cascade, channel activity was detected in 26 of 50 patches. This increase in channel detection rate was abolished if cells were incubated before patching with 100 µmol/L ATP
S in the presence of 1 µmol/L calphostin C, a specific blocker of PKC (4 of 27 cells). To confirm the implication of the PKC pathway in channel activation, cells were incubated with the PKC activator PMA (0.5 µmol/L). Data summarized in Figure 3E indicate an increase in channel detection (46 of 78 patches).
Channel Detection in WKY and SHR Rats
To evaluate the effect of chronic hypertension on the functional expression of the NSCCa channel, detection of the channel was also investigated in freshly isolated cardiomyocytes from normotensive rats. Results indicate that no activity was detected under control conditions (0 of 25) and that only a few patches showed channel activity after preincubation with either ATP
S or PMA (1 of 28 and 3 of 41 cells, respectively; not statistically different from control). These data match with previous reports describing only a low detection rate or absence of channel activity in freshly isolated ventricular cells from normotensive rats12,13 or guinea pigs.27 The mean number of active channels per patch was calculated and called channel density. As reported in Figure 4A, channel density was significantly higher in SHRs compare with WKY in PMA-treated cells.
|
To eliminate the hypothesis that the increase in channel density arises from a genetic disparity, channel density was evaluate in the function of cardiac hypertrophy in SHRs. Animals were pooled by age when cardiac hypertrophy develops (3 to 5 animals for each batch), then mean heart/body ratio and channel density after PMA treatment were calculated. A significant positive correlation was found between cardiac hypertrophy and channel density (Figure 4B).
TRPM4 and TRPM5 mRNA Expression in Ventricular Cells
The cardiac NSCCa channel described here shares biophysical properties with the TRPM4 channel.14 RT-PCR was used to probe for TRPM4 in WKY and SHR cardiac tissues. Atrial and left ventricular samples were used. In accordance with our previous report on human atrial cells,22 TRPM4 messenger was detected in the atrium from both WKY rats and SHRs. At the ventricular level, TRPM4 messenger was only weakly detected in WKY rats. The mean optical density significantly (TRPM4/18S) increased by 5-fold in SHRs compare with WKY rats. Figure 4C and 4D shows an example of amplification and the mean optical density ratio histogram. Amplified products were sequenced and were similar (98%) to the predicted rat TRPM4 mRNA sequence (MN 133607).
We also preformed RT-PCRs to probe for TRPM5, which is structurally and functionally close to TRPM4. A significant level of amplified product was detected in both WKY and SHR ventricle, but no significant variation was observed related to hypertrophy (density ratios TRPM5/18S: 0.78±0.12 in WKY, n=4, and 0.5±0.15 in SHR, n=3).
| Discussion |
|---|
|
|
|---|
S or PMA. This increase was abolished in the presence of the PKC inhibitor calphostin C. We reported previously the presence of such a channel in human atrial cardiomyocytes and dedifferentiated cardiomyocytes from the WKY rat ventricle.12,22 Values for single channel conductance, ionic permeabilities, and dependence on calcium and PKC were similar to those observed here in SHRs. The recent discovery of the transient receptor potential (TRP) protein family has revived interest in nonselective cation channels. Within the TRPM subfamily,28 TRPM4 generates a current similar to that observed in SHR ventricular cardiomyocytes. TRPM4 acts as a nonselective cation channel of 25 pS that is activated by [Ca2+]i, with a Kd ranging between 0.414 and 9.8 µmol/L;29 its voltage dependence follows a Boltzmann-type relationship with a V0.5=9.7 mV. It is equally selective for Na+ and K+14 and is blocked by intracellular free-ATP in the 10 µmol/L range.16 In addition, activation of the TRPM4 current by PKC was also reported when expressed in HEK293 cells.30
The cardiac NSCCa might also be generated by TRPM5, which acts as a 25-pS voltage and calcium-sensitive nonselective cation channel.31 However, TRPM5 is not inhibited by ATP.17 Also, TRPM4 has a higher sensitivity to flufenamic acid than TRPM5, with estimated IC50 values of 2.8 and 24.5 µmol/L, respectively.17 The cardiac NSCCa IC50 value of 5.5 µmol/L is closer to that of TRPM4. Finally, a third difference to be highlighted is the presence of an ABC signature motif in TRPM4 that is absent in TRPM5.17 Inhibition of the cardiac NSCCa by glibenclamide indicates possible similarities with the cystic fibrosis transmembrane conductance regulator and sulfonylurea receptors that have the ABC signature. Taken together, the cardiac NSCCa properties match the TRPM4 fingerprint almost perfectly, showing that TRPM4 is the molecular correlate of this channel.
Current Detection and Hypertrophy
The major finding arising from the present study is the detection of an increase in the TRPM4 current activity in myocytes from SHRs compare with WKY rats. Indeed, channel activity was rarely observed in freshly isolated cardiomyocytes from normotensive rats, even after PKC stimulation. On the contrary, in SHRs, it was recorded in >50% of patches in such conditions. This altered activity could be because of an increase in TRPM4 protein expression or an increase in a factor such as PKC that alters its activity. Both are probably implicated. First, it was reported that diacyl-glycerol content and PKC activity increase during cardiac hypertrophy.32,33 Second, the rise in TRPM4 mRNA expression reported here is in favor of an increase in the amount of proteins.
The activation properties of TRPM4 predict a complex physiological implication. Both depolarizing phases and increases of internal calcium will favor its activation. Then, according to its equal selectivity for Na+ and K+, it will produce a combination between an inward depolarizing Na+ current and an outward repolarizing K+ current. Calcium waves appear in SHR myocytes during the development of hypertrophy, which, in turn, induce DADs.10 DADs are because of the development of a calcium-dependant current, called the transient inward current (Iti). Iti has been extensively studied in cardiac cells, and is assumed to be composed of
3 components; the Na+/Ca2+ exchanger,34,35 a [Ca2+]i-activated chloride current,36,37 and a [Ca2+]i-activated nonselective cation current.38,39 The channels responsible for this third component have not been described at the unitary level. A 30 to 40 pS calcium-activated nonselective channel has been described in neonate rat myocytes40; however, its presence was not reported in adult cells. The present description of TRPM4 in SHRs provides another candidate for this current, because intracellular calcium is also one of its major regulators. Interestingly, in human cardiomyocytes, a calcium-activated nonselective cation current at the whole-cell level was reported to be implicated in Iti.41 This whole-cell calcium-activated nonselective cation current was detected in atria but not in ventricles. That is in accordance with our results. Indeed, in human atria, we detected TRPM4 single channels currents22 but no currents or weak currents in normotensive rat ventricles. Also, in those rats, TRPM4 mRNA was higher in atria than ventricles. Thus, we hypothesize that TRPM4 could participate in Iti in atrial but not ventricular normotensive rat cardiomyocytes. On the other hand, it could contribute to this current in SHR ventricular cells and, thus, participate in the increase in DAD occurrences in those rats.
Also, TRPM4 could participate in the proarrhythmic early after depolarizations (EADs) during the cardiac action potential. Indeed, EADs are associated with secondary Ca2+ release of the sarcoplasmic reticulum.42 In addition, because the cell is depolarized by the time of action potential, TRPM4 is in its voltage range of activation. By producing its nonselective cation current, it would participate to the perpetuation of EADs. Although no data are available in SHRs, it has to be noted that ventricular hypertrophy induces EADs in a rabbit heart.43 Moreover, as Ca2+ transient that is increased in SHR modifies APD by modulating Ca2+-sensitive channels, the presence of TRPM4 in SHRs could participate to the increase of APD reported in SHRs.4,5
Because its biophysical and regulatory properties close to TRPM4, one can imagine that TRPM5 could also participate in these Ca2+-induced mechanisms. However, whereas we detected TRPM5 mRNA in ventricles, we did not identify the channel at the functional level. Also, its expression was not modified in SHRs.
In conclusion, we infer that the TRPM4 current is expressed in SHR ventricular myocytes and, because of its electrophysiological properties, it could participate in several processes of cardiac arrhythmias associated with hypertrophy.
Perspectives
We showed the presence of a TRPM4 current in SHR cardiomyocytes and infer that it could, among other ionic components, participate in proarrhythmic processes related to cardiac hypertrophy. The development of specific pharmacological tools for TRPM4 would permit the determination of its contribution to the ventricular cardiac action potential and its modifications induced by hypertrophy. Also, production of TRPM4 knockout mice will be a step forward in elucidating its function in cardiac electrical activity. The knowledge of this current should help in the understanding of the action of pharmacological compounds used in the modulation of cardiac activity and then sharpen their action.
| Acknowledgments |
|---|
Sources of Funding
This study was supported by funding from the French Centre National de la Recherche Scientifique and the University of Poitiers. M.D. holds a PhD fellowship from the French Ministère de lEnseignement et de la Recherche.
Disclosures
None.
Received May 10, 2006; first decision May 30, 2006; accepted July 11, 2006.
| References |
|---|
|
|
|---|
2. Brooksby P, Levi AJ, Jones JV. Contractile properties of ventricular myocytes isolated from spontaneously hypertensive rat. J Hypertens. 1992; 10: 521527.[Medline] [Order article via Infotrieve]
3. Shorofsky SR, Aggarwal R, Corretti M, Baffa JM, Strum JM, Al-Seikhan BA, Kobayashi YM, Jones LR, Wier WG, Balke CW. Cellular mechanisms of altered contractility in the hypertrophied heart: big hearts, big sparks. Circ Res. 1999; 84: 424434.
4. Brooksby P, Levi AJ, Jones JV. Investigation of the mechanisms underlying the increased contraction of hypertrophied ventricular myocytes isolated from the spontaneously hypertensive rat. Cardiovasc Res. 1993; 27: 12681277.
5. McCrossan ZA, Billeter R, White E. Transmural changes in size, contractile and electrical properties of SHR left ventricular myocytes during compensated hypertrophy. Cardiovasc Res. 2004; 63: 283292.
6. Baillard C, Mansier P, Ennezat PV, Mangin L, Medigue C, Swynghedauw B, Chevalier B. Converting enzyme inhibition normalizes QT interval in spontaneously hypertensive rats. Hypertension. 2000; 36: 350354.
7. Cerbai E, Barbieri M, Li Q, Mugelli A. Ionic basis of action potential prolongation of hypertrophied cardiac myocytes isolated from hypertensive rats of different ages. Cardiovasc Res. 1994; 28: 11801187.
8. Cerbai E, Barbieri M, Mugelli A. Characterization of the hyperpolarization-activated current, I(f), in ventricular myocytes isolated from hypertensive rats. J Physiol. 1994; 481: 585591.
9. Cerbai E, Barbieri M, Mugelli A. Occurrence and properties of the hyperpolarization-activated current If in ventricular myocytes from normotensive and hypertensive rats during aging. Circulation. 1996; 94: 16741681.
10. Ruocco C, Cerbai E, Failli P, Giotti A, Mugelli A. Calcium-dependent electrophysiological alterations in hypertrophied rat cardiomyocytes. Biochem Biophys Res Commun. 1996; 229: 425429.[CrossRef][Medline] [Order article via Infotrieve]
11. Failli P, Ruocco C, Fazzini A, Giotti A. Calcium waves in unstimulated left ventricular cardiomyocytes isolated from aged spontaneously hypertensive and normotensive rats. Biochem Biophys Res Commun. 1997; 237: 103106.[CrossRef][Medline] [Order article via Infotrieve]
12. Guinamard R, Rahmati M, Lenfant J, Bois P. Characterization of a Ca2+-activated nonselective cation channel during dedifferentiation of cultured rat ventricular cardiomyocytes. J Memb Biol. 2002; 188: 127135.[CrossRef][Medline] [Order article via Infotrieve]
13. Guinamard R, Chatelier A, Lenfant J, Bois P. Activation of the Ca2+-activated nonselective cation channel by Diacylglycerol analogues in rat cardiomyocytes. J Cardiovasc Electrophysiol. 2004; 15: 342348.[Medline] [Order article via Infotrieve]
14. Launay P, Fleig A, Perraud AL, Scharenberg AM, Penner R, Kinet JP. TRPM4 is a Ca2+-activated nonselective cation channel mediating cell membrane depolarization. Cell. 2002; 109: 397407.[CrossRef][Medline] [Order article via Infotrieve]
15. Nilius B, Prenen J, Droogmans G, Voets T, Vennekens R, Freichel M, Wissenbach U, Flockerzi. Voltage dependence of the Ca2+-activated cation channel TRPM4. J Biol Chem. 2003; 278: 3081330820.
16. Nilius B, Prenen J, Voets T, Droogmans G. Intracellular nucleotides and polyamines inhibit the Ca2+-activated cation channel TRPM4b. Pflügers Arch. 2004; 448: 7075.[CrossRef][Medline] [Order article via Infotrieve]
17. Ullrich ND, Voets T, Prenen J, Vennekens R, Talavera K, Droogmans G, Nilius B. Comparison of functional properties of the Ca2+-activated cation channels TRPM4 and TRPM5 from mice. Cell Calcium. 2005; 37: 267278.[CrossRef][Medline] [Order article via Infotrieve]
18. Isenberg G, Klockner U. Calcium tolerant ventricular myocytes prepared by preincubation in a "KB medium." Pflugers Arch. 1982; 395: 618.[CrossRef][Medline] [Order article via Infotrieve]
19. Teulon J, Paulais M, Bouthier M. A Ca2+-activated cation-selective channel in the basolateral membrane of the cortical thick ascending limb of Henles loop of the mouse. Biochim Biophys Acta. 1987; 905: 125132.[Medline] [Order article via Infotrieve]
20. Mitchell GF, Jeron A, Koren G. Measurement of heart rate and Q-T interval in the conscious mouse. Am J Physiol. 1998; 274: 747751.
21. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cell-free membrane patches. Pflügers Arch. 1981; 391: 85100.[CrossRef][Medline] [Order article via Infotrieve]
22. Guinamard R, Chatelier A, Demion M, Potreau D, Patri S, Rahmati M, Bois P. Functional characterization of a Ca2+-activated non-selective cation channel in human atrial cardiomyocytes. J Physiol. 2004; 558: 7583.
23. Teulon J. Ca2+-activated nonselective cation channels. In: Endo M, Kurachi Y, Mishina M, ed. Pharmacology of Ionic Channel Function: Activators and Inhibitors. Berlin, Germany: Springer-Verlag; 2000: 625649.
24. Chen M, Dong Y, Simard JM. Functional coupling between Sulfonylurea receptor type 1 and a nonselective cation channel in reactive astrocytes from adult rat brain. J Neurosci. 2003; 23: 85688577.
25. Gogelein H, Dahlem D, Englert H, Lang HJ. Flufenamic acid, mefenamic acid and niflumic acid inhibit single nonselective cation channel in the rat exocrine pancreas. FEBS Lett. 1990; 268: 7982.[CrossRef][Medline] [Order article via Infotrieve]
26. Earley S, Waldron BJ, Brayden JE. Critical role for transient receptor potential channel TRPM4 in myogenic constriction of cerebral arteries. Circ Res. 2004; 95: 922929.
27. Ehara T, Noma A, Ono K. Calcium-activated non-selective cation channel in ventricular cells isolated from adult guinea-pig hearts. J Physiol. 1988; 403: 117133.
28. Fleig A, Penner R. The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol Sci. 2004; 25: 633639.[CrossRef][Medline] [Order article via Infotrieve]
29. Nilius B, Prenen J, Janssens A, Voets T, Droogmans G. Decavanadate modulates gating of TRPM4 cation channels. J Physiol. 2004; 560: 753765.
30. Nilius B, Prenen J, Tang J, Wang C, Owsianik G, Janssens A, Voets T, Zhu MX. Regulation of the Ca2+ sensitivity of the nonselective cation channel TRPM4. J Biol Chem. 2005; 280: 64236433.
31. Hofmann T, Chubanov V, Gudermann T, Montell C. TRPM5 is a voltage-modulated and Ca2+-activated monovalent selective cation channel. Curr Biol. 2003; 13: 11531158.[CrossRef][Medline] [Order article via Infotrieve]
32. Kondo J, Yamada Y, Okumura K, Hashimoto H, Ito T, Satake T. 1,2-Diacylglycerol content in myocardium from spontaneously hypertensive rats during the development of hypertension. Basic Res Cardiol. 1990; 85: 453460.[CrossRef][Medline] [Order article via Infotrieve]
33. Kim L, Lee T, Fu J, Ritchie ME. Characterization of MAP kinase and PKC isoform and effect of ACE inhibition in hypertrophy in vivo. Am J Physiol. 1999; 277: H1808H1816.[Medline] [Order article via Infotrieve]
34. Karaguezian HS, Katzung BG. Voltage-clamp studies of transient inward current and mechanical oscillations induced by ouabain in ferret papillary muscle. J Physiol. 1982; 327: 255271.
35. Verkerk A, Veldkamp MW, Baartscheer A, Schumacher CA, Klopping C, van Ginneken AC, Ravesloot JH. Ionic mechanisms of delayed afterdepolarizations in ventricular cells isolated from human end-stage failing hearts. Circulation. 2001; 104: 27282733.
36. Zygmunt AC. Intracellular calcium activates a chloride current in canine ventricular myocytes. Am J physiol. 1994; 267: H1984H1195.[Medline] [Order article via Infotrieve]
37. Verkerk AO, Veldkamp MW, Bouman LN, van Ginneken AC. Calcium-activated Cl current contributes to delayed after depolarizations in single Purkinje and ventricular myocytes. Circulation. 2000; 101: 26392644.
38. Hill JA, Coronado R, Strauss HC. Reconstitution and characterization of a calcium-activated channel from heart. Circ Res. 1988; 62: 411415.
39. Thandroyen FT, Morris AC, Hagler HK, Ziman B, Pai L, Willerson JT, Buja LM. Intracellular calcium transients and arrhythmia in isolated heart cells. Circ Res. 1991; 69: 810819.
40. Colquhoun D, Neher E, Reuter H, Stevens CF. Inward current channels activated by intracellular Ca in cultured cardiac cells. Nature (Lond). 1981; 294: 752754.[CrossRef][Medline] [Order article via Infotrieve]
41. Köster OF, Szigeti GP, Beuckelmann DJ. Characterization of a [Ca2+]i-dependent current in human atrial and ventricular cardiomyocytes in the absence of Na+ and K+. Cardiovasc Res. 1999; 41: 175185.[CrossRef][Medline] [Order article via Infotrieve]
42. Verkerk AO, Tan HL, Kirkels JH, Ravesloot JH. Role of Ca2+-activated Cl current during proarrhythmic early afterdepolarizations in sheep and human ventricular myocytes. Acta Physiol Scand. 2003; 179: 143148.[CrossRef][Medline] [Order article via Infotrieve]
43. Yan GX, Rials SJ, Wu Y, Liu T, Xu X, Marinchak RA, Kowey PR. Ventricular hypertrophy amplifies transmural repolarization dispersion and induces early after depolarization. Am J Physiol Heart Circ Physiol. 2001; 281: 19681975.
This article has been cited by other articles:
![]() |
S. C.M. Choisy, L. A. Arberry, J. C. Hancox, and A. F. James Increased Susceptibility to Atrial Tachyarrhythmia in Spontaneously Hypertensive Rat Hearts Hypertension, March 1, 2007; 49(3): 498 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Demion, P. Bois, P. Launay, and R. Guinamard TRPM4, a Ca2+-activated nonselective cation channel in mouse sino-atrial node cells Cardiovasc Res, February 1, 2007; 73(3): 531 - 538. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |