| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2008;51:507.)
© 2008 American Heart Association, Inc.
Original Articles Part 2 |
From the Department of Integrated Medicine and Informatics, Ehime University Graduate School of Medicine, Shitsukawa, Japan.
Correspondence to Takafumi Okura, MD, PhD, Department of Integrated Medicine and Informatics, Ehime University Graduate School of Medicine, Shitsukawa, Toon City, Ehime, 791-0295, Japan. E-mail okura{at}m.ehime-u.ac.jp
| Abstract |
|---|
|
|
|---|
B) site. Electrophoretic mobility shift assays, supershift assays, and chromatin immunoprecipitation assays identified both AP-1 and NF
B as the DNA binding proteins induced by aldosterone with spironolactone inhibiting aldosterone-induced AP-1 or NF
B activity. OPN-siRNA inhibited completely the induction of cell proliferation, type I, III, and IV collagen synthesis by aldosterone. These results indicate that aldosterone induced MR-mediated OPN expression through AP-1 and NF
B activation and suggest that aldosterone plays an important role in renal fibrosis through the induction of OPN.
Key Words: osteopontin aldosterone activator protein-1 nuclear factor kappa B mineralocorticoid receptor renal fibrosis
| Introduction |
|---|
|
|
|---|
OPN expression is induced by many growth factors and cytokines such as angiotensin II, basic fibroblast growth factor,3 and aldosterone. Aldosterone binds to the mineralocorticoid receptor (MR) and plays an important role in the pathophysiology of renal disease. An animal model of hypertension caused by aldosterone and salt overload exhibits renal injury with increasing proinflammatory cytokines including OPN.4 Aldosterone directly acts on the MR of endothelial cells to induce OPN gene expression5 and it is therefore of interest that we have recently reported the independent association of plasma OPN levels with serum aldosterone levels in patients with essential hypertension.6 In addition, plasma OPN levels were higher in patients with primary aldosteronism than with essential hypertension.7 One of the direct actions of aldosterone may be the induction of systemic fibrosis by increasing proinflammatory cytokines including OPN.
Previous studies have shown that various inducers regulate OPN expression at the transcriptional level with transcription factors such as Sp-1,8 activator protein 1 (AP-1),9,10 and nuclear factor kappa B (NF
B).10 However, the transcriptional regulatory mechanism of OPN by aldosterone remains unclear. In the present study, we demonstrated that aldosterone induces the transcription of the OPN gene through AP-1 and NF
B via MR and plays an important role in renal fibrosis via OPN induction.
| Methods |
|---|
|
|
|---|
Cell Culture
The Animal Studies Committee of Ehime University approved the following experimental protocol. Rat renal fibroblast cell line (NRK-49F) was purchased from the American Type Culture Collection. Renal fibroblasts were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin as directed. The culture medium of subconfluent cells was replaced with 0.1% FBS medium for 48 hours to render the cells quiescent for use in subsequent experiments. Individual experiments were repeated at least 3 times with different preparations of cells.
Chromatin Immunoprecipitation Assay
A chromatin immunoprecipitation (ChIP) assay was performed using ChIP assay kit (Upstate) according to the manufacturers instructions. Soluble chromatin was prepared from renal fibroblasts treated with 10 µmol/L spironolactone for 1 hour followed by stimulation with aldosterone (100 nmol/L) for 30 minutes. Chromatin was immunoprecipitated with the indicated antibodies (2 µg each). The extracted DNAs were polymerase chain reaction (PCR) amplified using primer pairs that cover AP-1 sequence in the OPN promoter as follows: forward 5'-GTTGAGTCATTCCTGTGGGC-3'; antisense 5'-GCCCTTTAAGCACGACACCC-3', NF
B sequence as follows: forward 5'-GTTGAGTCATTCCTGTGGGC-3'; antisense 5'- GACAACACCTGTGACTATCG -3'.
Statistical Analysis
Significance was determined using unpaired Student t test, Mann-Whitney U test, or ANOVA, followed by Tukey test. All data are expressed as mean±SD, and statistical significance was defined as P<0.05.
| Results |
|---|
|
|
|---|
|
OPN Expression Induced by Aldosterone Is via MR
We used a selective MR antagonist spironolactone to determine whether aldosterone-induced OPN expression was mediated via the MR. The induction of OPN mRNA expression by aldosterone (100 nmol/L) was completely blocked by pretreatment with spironolactone (10 µmol/L) thereby indicating that aldosterone-induced OPN gene expression in renal fibroblasts is mediated via the MR (Figure 1C). In addition, the aldosterone-induced OPN gene expression was completely inhibited by pretreatment with a transcription inhibitor, actinomycin D (5 µmol/L), indicating its transcription-dependent action (Figure 1C).
Identification of cis-Regulatory Element in the OPN Promoter
To identify the cis-regulating elements of the OPN promoter that regulated OPN gene transcription induced by aldosterone in renal fibroblasts, we constructed a set of pGL4 plasmids carrying 5' deletions of the OPN promoter (Figure 2A). Luciferase reporter activity was determined in renal fibroblasts transiently transfected with these deleted constructs and then stimulated by aldosterone (100 nmol/L) for 24 hours. Luciferase activity of Luc-2153 (2.3±0.2-fold, P<0.001, n=24) and Luc-1839 (2.6±0.3-fold, P<0.001, n=24) in aldosterone-stimulated cells was higher than unstimulated cells, whereas Luc-1758 to Luc-174 led to the loss of luciferase activity by aldosterone stimulation. These results suggested that a cis-regulating element responding to aldosterone was located in the –2153 to –1758 region of the distal OPN promoter.
|
Effect of Point Mutagenesis of the AP-1 or NF
B Binding Motif on Promoter Activity
We searched for transcription factor binding sites between –2153 to –1758 with TFSEACH (http://mbs.cbrc.jp/research/ db/TFSEACH.html). This region contained an AP-1 binding site at –1870 and a NF
B binding site at –1800. Both the AP-1 and the NF
B binding site mutation abolished the activation of promoter activity by aldosterone (Figure 2C).
Electrophoretic Mobility Shift Assay Analysis With the AP-1 and NF
B Binding Site in the –2153 to –1758 Region of the OPN Promoter
When nuclear extracts were incubated in the presence of the 32P-labeled probe 1 (containing AP-1 potential site), the complex density peaked at 1 hour in the nuclear extracts of cells treated by aldosterone and remained elevated for 3 hours (Figure 3A). After the addition of an excess of cold probe 1, only the upper complex disappeared, thereby indicating that the lower complex was a nonspecific band. Incubation of nuclear extracts from aldosterone-stimulated cells with the 32P-labeled probe 2 (containing NF
B potential site) resulted in complexes being detected by electrophoretic mobility shift assay (EMSA) (Figure 3B). Binding of factors to the NF
B site was maximal at 30 minutes of treatment with aldosterone. These complexes disappeared when an excess of the specific cold probe 2 was added but not after the addition of an excess of nonspecific cold probe. We next examined the effect of spironolactone on the formation of protein/DNA complexes at each AP-1 or NF
B binding site on the OPN promoter sequence (Figure 3A and 3B). Spironolactone (10 µmol/L) inhibited aldosterone-induced AP-1 and NF
B binding activities. These findings indicated that aldosterone induces AP-1 and NF
B activity through the MR.
|
The AP-1 Site Activity by c-Fos and c-Jun and the NF
B Site Activity by p65 of the OPN Promoter
We next performed supershift experiments using anti–c-Fos and c-Jun antibody (Figure 4A). Antibody against c-Fos substantially diminished complex formation and supershifted complexes using probe 1 in the OPN promoter. In addition, anti–c-Jun antibody partially supershifted the AP-1 complex, whereas anti-NF
B antibodies to p50 and p65 had no effect on the AP-1 complex formation. This experiment showed that the transcription factors c-Fos and c-Jun are both components of the aldosterone-activated complex.
|
Supershift assays using anti-p50 or -p65 anti-NF
B antibodies were performed to identify the transcription factors binding the NF
B site (Figure 4B). When anti-p65 antibody was added to nuclear extracts isolated from aldosterone-stimulated cells, a diminished and supershift complex was observed but this was not evident after the addition of anti-p50 antibody. In contrast, no modification was observed when an anti–c-Fos and c-Jun antibody was used. These results demonstrate that p65 NF
B binds the site located at –1800 in nuclear extracts.
To confirm that c-Fos, c-Jun, and p65 bind to the endogenous OPN promoter we next performed ChIP assays (Figure 4C). ChIP assays demonstrated that this OPN promoter region coimmunoprecipitated with c-Fos, c-Jun, and p65 after stimulation with aldosterone. These inductions were inhibited by spironolactone.
Role of AP-1 and NF
B in the Aldosterone-Induced OPN Expression
To evaluate the role of AP-1 in the induction of OPN mRNA expression by aldosterone, we used a phosphorothioate-modified oligodeoxynucleotide (ODN) containing the specific sequence for AP-1 or NF
B on the OPN promoter. The decoy ODNs were added to renal fibroblasts 6 hours before aldosterone stimulation. As shown in Figure 5, each decoy ODN inhibited aldosterone-induced OPN mRNA expression. These results strongly indicated that aldosterone-induced OPN expression involves both AP-1 and NF
B.
|
Inhibitory Effect of OPN Small Interfering RNA on the Stimulation of Renal Fibroblast Cell Proliferation and Collagen Gene Expression by Aldosterone
To assess the role of the upregulated OPN expression by aldosterone, we analyzed cell proliferation and collagen synthesis in OPN knockdown cells treated by RNA interference. To confirm the effectiveness of OPN-small interfering RNA (siRNA), we performed immunoblot analysis and determined the OPN expression level (Figure 6A). Compared with control siRNA-treated cells, OPN expression was suppressed significantly with almost negligible expression evident in OPN siRNA-treated cells. Furthermore, aldosterone treatment significantly increased the induction of cell proliferation (145±7% of controls, P<0.05, n=60; Figure 6B) and collagens type I (155±13% of controls, P<0.05, n=5), III (170±14% of controls, P<0.01, n=5), and IV (163±20% of controls, P<0.01, n=5) mRNA synthesis (Figure 6C). Aldosterone-induced increases in cell proliferation and collagen I, III, and IV collagen expression were significantly inhibited by OPN siRNA transfection (105±6% of controls, 102±11% of controls, 58±10% of controls, 103±12% of controls, respectively, n=5). These results suggested that aldosterone-induced OPN expression plays an important role in renal fibrosis.
|
| Discussion |
|---|
|
|
|---|
B as shown in this study. Li et al reported that aldosterone increased NF
B activity and NF
B target gene-tumor necrosis factor (TNF)-
gene expression in hepatic stellate cells (HSCs) T6 cells. Aldosterone also increased AP-1 activity and
1 protocollagen gene expression, an AP-1 target gene, in HSC-T6 cells.15 They concluded that aldosterone mediates hepatic fibrogenesis via stimulation of the NF
B and AP-1 pathway. Although they did not mention OPN expression in their study, their work and our study indicate that aldosterone stimulates the transcriptional factors NF
B and AP-1 and can induce organ fibrosis.
A complete loss of inducible OPN promoter activity after each point mutagenesis of AP-1 or NF
B site strongly suggested an interaction between AP-1 and NF
B as well as the importance of these sites on transcriptional activity of the OPN promoter. Moreover, NF
B has been reported to interact with some transcription factors including AP-1.16 However, in the present study, no modification was observed when anti–c-Fos or c-Jun and anti-p65 antibody was added to the nuclear extract with probe 2 and probe 1 in the EMSA, respectively. These results suggest that NF
B and AP-1 independently contribute to the induction of OPN during aldosterone stimulation in renal fibroblasts. However further study is needed to clarify the interaction between AP-1 and NF
B on stimulation of OPN gene transcription.
Previously, the AP-1 binding site –1870 and the NF
B binding site –1800 in the rat OPN promoter has been reported to be the cis elements which activate OPN promoter activity by uridine triphosphate (UTP) in smooth muscle cells.9,17 In the AP-1 binding site –1870, UTP induces AP-1 activation by both c-Fos and cAMP responsive element-binding protein (CREB) binding. We performed the supershift assay using anti-CREB antibody and the AP-1 complex was not influenced, thereby indicating that CREB is not involved in the transcriptional regulation of OPN by aldosterone in renal fibroblasts (data not shown). The signal transduction system of OPN gene transcription by UTP is similar but not identical to that of aldosterone.
We demonstrated, using EMSA and ChIP assay experiments, that spironolactone suppresses AP-1 and NF
B binding to each response element in the OPN promoter suggesting that AP-1 and NF
B binding and activation is initiated through the MR in renal fibroblasts. Nishiyama et al reported that eplerenone, a selective MR antagonist, attenuated the rapid action of aldosterone on extracellular signal regulated kinase (ERK) 1/2 phosphorylation in rat mesangial cells. Because this rapid ERK1/2 phosphorylation for 10 minutes was not influenced by either actinomysin D or cycloheximide, they proposed that this phenomenon was a nongenomic effect and mediated through the MR.18 NF
B can be involved in rapid transcription without new protein synthesis. In the present study, aldosterone activated NF
B for 30 minutes suggesting that aldosterone transactivated NF
B by a nongenomic effect through the MR. In contrast, AP-1 activation requires transcription. Our study demonstrated that aldosterone activated AP-1 for 1 hour suggesting that aldosterone transactivates AP-1 by genomic action through the MR. However, additional studies are necessary to delineate in more detail the molecular mechanism involved in the regulation of c-Fos/c-Jun and p65 transactivation by aldosterone.
Downstream events that followed aldosterone-stimulated OPN expression are demonstrated in the present study. Nagai et al reported that aldosterone stimulated collagen gene expression, including collagens type I, III, and IV, and collagen synthesis via MR-mediated ERK1/2 activation in NRK-49F renal fibroblasts.11 Collagens type I and III are matrix proteins that are produced in excess during renal fibrosis. Previous studies have reported that not only collagens type I and III but also collagen type IV, a basal membrane protein, is increased in patients with renal fibrosis such as crescentic glomerulonephritis.19,20 Goumenos et al demonstrated that the site of synthesis of collagen III and IV appeared to be confined to fibroblasts in crescentic glomerulonephritis.20 These findings suggest that renal fibroblasts play an important role in renal fibrosis through the synthesis of collagen types I, III, and IV. In the present study, RNA interference of OPN expression significantly reduced cell proliferation and the gene expression of collagens type I, III, and IV. The present study therefore indicates that aldosterone-induced OPN expression plays a key role in aldosterone-induced renal fibrosis.
Perspectives
The present data demonstrated that aldosterone-induced OPN expression in renal fibroblasts depends on AP-1 and NF
B binding to the distal OPN promoter. Spironolactone inhibited aldosterone-induced OPN expression and reduced AP-1 and NF
B binding to the OPN promoter. OPN siRNA suppressed aldosterone-induced cell proliferation and collagen gene expression. Because OPN is a key component for the aldosterone-induced renal fibrosis, inhibition of OPN could provide a potential target for therapeutic intervention in renal disease.
| Acknowledgments |
|---|
None.
Received October 11, 2007; first decision October 30, 2007; accepted November 27, 2007.
| References |
|---|
|
|
|---|
2. Yoo KH, Thornhill BA, Forbes MS, Coleman CM, Marcinko ES, Liaw L, Chevalier RL. Osteopontin regulates renal apoptosis and interstitial fibrosis in neonatal chronic unilateral ureteral obstruction. Kidney Int. 2006; 70: 1735–1741.[CrossRef][Medline] [Order article via Infotrieve]
3. Giachelli CM, Bae N, Almeida M, Denhardt DT, Alpers CE, Schwartz SM. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest. 1993; 92: 1686–1696.[Medline] [Order article via Infotrieve]
4. Blasi ER, Rocha R, Rudolph AE, Blomme EA, Polly ML, McMahon EG. Aldosterone/salt induces renal inflammation and fibrosis in hypertensive rats. Kidney Int. 2003; 63: 1791–1800.[CrossRef][Medline] [Order article via Infotrieve]
5. Sugiyama T, Yoshimoto T, Hirono Y, Suzuki N, Sakurada M, Tsuchiya K, Minami I, Iwashima F, Sakai H, Tateno T, Sato R, Hirata Y. Aldosterone increases osteopontin gene expression in rat endothelial cells. Biochem Biophys Res Commun. 2005; 336: 163–167.[CrossRef][Medline] [Order article via Infotrieve]
6. Kurata M, Okura T, Watanabe S, Fukuoka T, Higaki J. Osteopontin and carotid atherosclerosis in patients with essential hypertension. Clin Sci (Lond). 2006; 111: 319–324.[Medline] [Order article via Infotrieve]
7. Irita J, Okura T, Manabe S, Kurata M, Miyoshi K, Watanabe S, Fukuoka T, Higaki J. Plasma osteopontin levels are higher in patients with primary aldosteronism than in patients with essential hypertension. Am J Hypertens. 2006; 19: 293–297.[CrossRef][Medline] [Order article via Infotrieve]
8. Wang D, Yamamoto S, Hijiya N, Benveniste EN, Gladson CL. Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions. Oncogene. 2000; 19: 5801–5809.[CrossRef][Medline] [Order article via Infotrieve]
9. Renault MA, Jalvy S, Potier M, Belloc I, Genot E, Dekker LV, Desgranges C, Gadeau AP. UTP induces osteopontin expression through a coordinate action of NFkappaB, activator protein-1 and upstream stimulatory factor in arterial smooth muscle cells. J Biol Chem. 2005; 280: 2708–2713.
10. Ogawa D, Stone JF, Takata Y, Blaschke F, Chu VH, Towler DA, Law RE, Hsueh WA, Bruemmer D. Liver X receptor agonists inhibit cytokine-induced osteopontin expression in macrophages through interference with activator protein-1 signaling pathways. Circ Res. 2005; 96: e59–e67.
11. Nagai Y, Miyata K, Sun GP, Rahman M, Kimura S, Miyatake A, Kiyomoto H, Kohno M, Abe Y, Yoshizumi M, Nishiyama A. Aldosterone stimulates collagen gene expression and synthesis via activation of ERK1/2 in rat renal fibroblasts. Hypertension. 2005; 46: 1039–1045.
12. Rocha R, Rudolph AE, Frierdich GE, Nachowiak DA, Kekec BK, Blomme EA, McMahon EG, Delyani JA. Aldosterone induces a vascular inflammatory phenotype in the rat heart. Am J Physiol Heart Circ Physiol. 2002; 283: H1802–H1810.
13. Derfoul A, Robertson NM, Lingrel JB, Hall DJ, Litwack G. Regulation of the human Na/K-ATPase beta1 gene promoter by mineralocorticoid and glucocorticoid receptors. J Biol Chem. 1998; 273: 20702–20711.
14. Gauer S, Hauser IA, Obermüller N, Holzmann Y, Geiger H, Goppelt-Struebe M. Synergistic induction of osteopontin by aldosterone and inflammatory cytokines in mesangial cells. J Cell Biochem. In press.
15. Li X, Meng Y, Wu P, Zhang Z, Yang X. Angiotensin II and Aldosterone stimulating NF-kappaB and AP-1 activation in hepatic fibrosis of rat. Regul Pept. 2007; 138: 15–25.[CrossRef][Medline] [Order article via Infotrieve]
16. Viedt C, Vogel J, Athanasiou T, Shen W, Orth SR, Kubler W, Kreuzer J. Monocyte chemoattractant protein-1 induces proliferation and interleukin-6 production in human smooth muscle cells by differential activation of nuclear factor-kappaB and activator protein-1. Arterioscler Thromb Vasc Biol. 2002; 22: 914–920.
17. Jalvy S, Renault MA, Lam Shang Leen L, Belloc I, Reynaud A, Gadeau AP, Desgranges C. CREB mediates UTP-directed arterial smooth muscle cell migration and expression of the chemotactic protein osteopontin via its interaction with activator protein-1 sites. Circ Res. 2007; 100: 1292–1299.
18. Nishiyama A, Yao L, Fan Y, Kyaw M, Kataoka N, Hashimoto K, Nagai Y, Nakamura E, Yoshizumi M, Shokoji T, Kimura S, Kiyomoto H, Tsujioka K, Kohno M, Tamaki T, Kajiya F, Abe Y. Involvement of aldosterone and mineralocorticoid receptors in rat mesangial cell proliferation and deformability. Hypertension. 2005; 45: 710–716.
19. Wiggins R, Goyal M, Merritt S, Killen PD. Vascular adventitial cell expression of collagen I messenger ribonucleic acid in anti-glomerular basement membrane antibody-induced crescentic nephritis in the rabbit. A cellular source for interstitial collagen synthesis in inflammatory renal disease. Lab Invest. 1993; 68: 557–565.[Medline] [Order article via Infotrieve]
20. Goumenos D, Tsomi K, Iatrou C, Oldroyd S, Sungur A, Papaioannides D, Moustakas G, Ziroyannis P, Mountokalakis T, El Nahas AM. Myofibroblasts and the progression of crescentic glomerulonephritis. Nephrol Dial Transplant. 1998; 13: 1652–1661.
This article has been cited by other articles:
![]() |
P. Klusonova, L. Rehakova, G. Borchert, K. Vagnerova, J. Neckar, P. Ergang, I. Miksik, F. Kolar, and J. Pacha Chronic Intermittent Hypoxia Induces 11{beta}-Hydroxysteroid Dehydrogenase in Rat Heart Endocrinology, September 1, 2009; 150(9): 4270 - 4277. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |