Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2008;51:899-904
Published online before print March 3, 2008, doi: 10.1161/HYPERTENSIONAHA.107.109173
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
51/4/899    most recent
HYPERTENSIONAHA.107.109173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, Z.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, Z.
Right arrow Articles by Liang, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Dietary Sodium
Related Collections
Right arrow Hypertension - basic studies

(Hypertension. 2008;51:899.)
© 2008 American Heart Association, Inc.


Original Articles

Renal Regional Proteomes in Young Dahl Salt-Sensitive Rats

Zhongmin Tian; Andrew S. Greene; Kristie Usa; Isaac R. Matus; Jesse Bauwens; Jennifer L. Pietrusz; Allen W. Cowley, Jr; Mingyu Liang

From the Department of Physiology (Z.T., A.S.G., K.U., J.B., J.L.P., A.W.C., M.L.), Biotechnology and Biomedical Engineering Center (Z.T., A.S.G., I.R.M.), Medical College of Wisconsin, Milwaukee; and the Department of Biomedical Engineering (Z.T.), Xi’an Jiaotong University, Xi’an, Shanxi, People’s Republic of China.

Correspondence to Mingyu Liang, Department of Physiology, Medical College of Wisconsin, Milwaukee, WI 53226. E-mail mliang{at}mcw.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
We performed an extensive proteomic analysis of the Dahl model of salt-sensitive hypertension. The consomic SS-13BN rat, genetically similar to the Dahl salt-sensitive rat, while exhibiting a significant amelioration of salt-induced hypertension, was used as a control. Proteomic analysis, using differential in-gel electrophoresis and mass spectrometry techniques, was performed in the renal cortex and the renal medulla of 6-week–old SS and SS-13BN rats before significant differences in blood pressure were developed between the 2 strains of rat. Several dozen proteins were identified as differentially expressed between SS and SS-13BN rats fed the 0.4% NaCl diet or switched to the 4% NaCl diet for 3 days (n=4). The identified proteins were involved in cellular functions or structures including signal transduction, energy metabolism, and the cytoskeleton. The proteomic analysis and subsequent Western blotting indicated that heterogeneous nuclear ribonucleoprotein K in the renal medulla was upregulated by the 4% NaCl diet in SS-13BN rats but downregulated in SS rats. The level of angiotensinogen mRNA in the renal medulla was regulated in an opposite manner. Silencing of heterogeneous nuclear ribonucleoprotein K resulted in an upregulation of angiotensinogen in cultured human kidney cells. In summary, we identified significant differences in kidney regional proteomic profiles between SS and SS-13BN rats and demonstrated a potential role of heterogeneous nuclear ribonucleoprotein K in the regulation of angiotensinogen expression in the renal medulla.


Key Words: hypertension • gene • proteomics • kidney • angiotensin


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
Arterial blood pressure of many essential hypertensive patients, especially African-American patients, exhibits an increased sensitivity to dietary salt intake.1 The molecular mechanisms underlying the exacerbated blood pressure salt sensitivity are not well understood.

The Dahl salt-sensitive (SS) rat is a commonly used model of human salt-sensitive forms of hypertension.2,3 Alterations in a number of physiological processes have been shown to be potentially involved in the increased blood pressure salt sensitivity in the SS rat. Particularly, abnormalities in the kidneys appear to play a critical role.4–6 The molecular mechanisms involved in the development of hypertension in SS rats, however, appear to be complex. For instance, quantitative trait loci analyses have indicated that multiple regions in several chromosomes are associated with the increased blood pressure salt sensitivity in the SS rat.7,8

The rat strains commonly used as controls for SS for physiological studies may contain many genetic or molecular differences from the SS that are unrelated to the hypertension phenotype. To reduce these confounding effects, various congenic or consomic rat strains have been generated by substituting a small part of the genome from salt-resistant strains of rat into the SS.9,10 Congenic or consomic SS rats that exhibit salt resistance may serve as useful controls for studying molecular pathways in the SS model.

One of the consomic strains, SS-13BN, has become a valuable control strain for the study of the SS model. Chromosome 13 is the only chromosome in the SS-13BN rat that is of the Brown Norway origin, making SS-13BN genetically 98% identical to SS, yet the blood pressure salt sensitivity is substantially reduced.11 Several interesting physiological differences have been identified between SS-13BN and SS rats, including a reduced level of oxidative stress in the renal medulla and changes in vascular reactivity.12,13

The goal of the present study was to identify differentially expressed proteins that might contribute to the difference in blood pressure salt sensitivity between SS and SS-13BN rats. Mean arterial blood pressure is typically 15 mm Hg higher in SS rats than in SS-13BN rats at 11 to 12 weeks of age, even if the rats have been maintained on the 0.4% NaCl diet.12 Differential expression of proteins in rats at this age would include secondary effects of the difference in blood pressure. We showed that we could avoid the confounding effect of the difference in blood pressure by using 6-week–old rats. Proteomic analysis identified several dozen proteins that were differentially expressed between 6-week–old SS and SS-13BN rats fed diets containing 0.4% or 4.0% NaCl. One of the differentially expressed proteins, heterogeneous nuclear ribonucleoprotein K, was shown to possibly play a role in the strain-specific regulation of angiotensinogen expression in the renal medulla.


*    Methods and Materials
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
SS and SS-13BN Rats
Male SS and consomic SS-13BN rats were generated and maintained as described previously.11,12,14 The animal protocols were approved by the Institutional Animal Care and Use Committee (172-05-1).

Measurement of Arterial Blood Pressure
Arterial blood pressure in conscious, freely moving rats was measured using catheters chronically implanted in the femoral artery as described previously.12,15 Rats were 5 weeks old at the time of surgery and 6 weeks old at the beginning of blood pressure measurement.

Dietary Treatment and Tissue Harvest
SS and SS-13BN rats were maintained on a purified AIN-76A rodent diet (Dyets) containing 0.4% NaCl and had free access to water. At 6 weeks of age, one half of the rats were switched to a diet containing 4% NaCl for 3 days. Kidneys were flushed in situ with cold normal saline. Renal cortex and renal medulla tissue was collected as described.14

Proteomic Analysis
Renal cortical and medullary proteomic profiles were compared between SS and SS-13BN rats (n=4) using differential in-gel electrophoresis and mass spectrometry techniques, as described previously.16 Briefly, protein samples from SS and SS-13BN rats were labeled with CyDye differential in-gel electrophoresis Fluor minimal dyes Cy3 or Cy5 (GE Healthcare), with the dyes switched between the 2 strains for every other gel. A pool of all of the samples was labeled with Cy2. Three labeled samples, including an SS, an SS-13BN, and the pool, were combined and separated by 2D gel electrophoresis. A total of 16 analytic gels were run (4 gels per comparison x2 diets x2 tissue types). The protein abundance was compared between SS and SS-13BN according to the intensity of each fluorescent dye within each spot. Criteria for differential expression were a P<0.05, a difference >1.2-fold, and the appearance of the spot in ≥3 of the 4 gels in a comparison. Differentially expressed protein spots were picked from preparative gels. The identities of differentially expressed proteins were obtained using mass spectrometry followed by Mascot searches.

Western Blot
Abundance of specific proteins was analyzed using Western blot as described previously.15–18 Coomassie blue staining was used to normalize the abundance of specific proteins. Antibodies for Cu-Zn containing superoxide dismutase, heterogeneous nuclear ribonucleoprotein K, and angiotensinogen were from Santa Cruz Biotechnology.

Chromatin Immunoprecipitation
Chromatin Immunoprecipitation (ChIP) analysis was performed using the EZ ChIP kit from Upstate (Millipore) following the manufacturer’s instructions except for the following modifications. Renal medulla samples were rinsed with PBS and cut into 1-mm3 pieces before cross-linking. Cross-linked samples were homogenized in the lysis buffer using 10 gentle strokes. The homogenate was sonicated on ice 4 times for 10 seconds each with 10-second intervals using a sonicator (Sonic Dismembrator 60, Fisher) at setting 3. Primers for the Hnrpk binding site in the rat angiotensinogen promoter were CCTTGATGCCTCCAACAACT (forward) and GGTGGGAGCTGAGAAGACAG (reverse).19 PCR was performed for 38 cycles.

Real-Time PCR
Real-time PCR analysis using the Taqman chemistry (Applied Biosystems) was performed as described previously.15,17,18,20 Oligonucleotide sequences for rat angiotensinogen were as follows: forward GCGCCTAAAACAGCCATTTG, reverse GCAAGAACTGGGTCAGTGGATAA, probe FAM-CCCCGCCATCTTCCCTCGCT-TAMRA.

Cell Culture
HK-2, a human kidney epithelial cell line, was obtained from and cultured as suggested by American Type Culture Collection.

RNA Interference
RNA interference was performed as described previously.17,18 The small interfering RNA (siRNA) target sequence in human heterogeneous nuclear ribonucleoprotein K was AATCTGATGCTGTGGAATGCT (Qiagen). Western blot or real-time PCR analysis was performed 48 hours after transfection.

Statistics
Data were analyzed using Student t test or ANOVA followed by the Holm-Sidak test. P<0.05 was considered significant. Data are shown as means±SEMs.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
*Results
down arrowDiscussion
down arrowReferences
 
Arterial Blood Pressure
Figure 1 shows that mean arterial blood pressure was not significantly different between 6-week–old SS and SS-13BN rats fed the 0.4% NaCl diet or switched to the 4% NaCl diet for several days. Mean arterial blood pressure diverged significantly after the rats were switched to the 4% NaCl diet for 7 days, confirming the reduction of blood pressure salt sensitivity in SS-13BN rats.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Figure 1. Mean arterial blood pressure in 6- to 8-week–old SS and SS-13BN rats. Rats were 6 weeks old on day 1. n=5 to 7; *P<0.05 vs SS-13BN.

Differential Proteome Profiles
Proteomic profiles in the renal cortex and the renal medulla were compared between 6-week–old SS and SS-13BN rats fed the 0.4% NaCl diet or switched to the 4% NaCl diet for 3 days. A summary of the throughput of the proteomic analysis is shown in Table 1. Note that a protein might be identified in multiple spots, and changes in individual spots can occur with no change in the total amount of a given protein.


View this table:
[in this window]
[in a new window]

 
Table 1. A Summary of the Throughput of the Proteomic Study

Differentially expressed proteins and their fold differences are reported in Tables 2 and 3DownDown. Additional information for each differentially expressed protein spot, including standardized gene name, chromosomal location, P value for the differential expression, and indexes of the confidence of protein identification is shown in Tables S1 and S2 (available online at http://hyper.ahajournals.org).


View this table:
[in this window]
[in a new window]

 
Table 2. Proteins Differentially Expressed Between 6-Week–Old SS and SS-13BN Rats on a 0.4% NaCl Diet


View this table:
[in this window]
[in a new window]

 
Table 2. Continued


View this table:
[in this window]
[in a new window]

 
Table 3. Proteins Differentially Expressed Between 6-Week–Old SS and SS-13BN Rats That Had Been Switched From a 0.4% NaCl Diet to a 4% NaCl Diet for 3 Days

A representative image of 2D differential in-gel electrophoresis is shown in Figure S1. Differential expression of Cu-Zn superoxide dismutase (Sod1) and heterogeneous nuclear ribonucleoprotein K (Hnrpk) was verified by Western blotting (Figure 2).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
Figure 2. Verification of proteomic results. Verification of proteomic results with Western blotting for 2 proteins with large (Hnrpk) or small (Sod1) fold changes according to the proteomic analysis. Medulla tissue from rats on the 0.4% NaCl diet was used. n=4; *P<0.05 vs SS.

The proteins differentially expressed between SS and SS-13BN rats were involved in a number of cellular functions or structures such as signal transduction, energy metabolism, and cytoskeleton. These include proteins such as heat shock proteins, transcriptional factors, mitochondrial enzymes, and tubulin components. Proteins encoded by several genes located on the substituted chromosome 13, including Actr3, Fh1, Serpinc1, and Tagln2, were found differentially expressed between SS and SS-13BN.

The emphasis of this study was on the comparison between the 2 strains. We also noticed that the changes in dietary salt intake appeared to affect >200 protein spots within each strain. We did not obtain the identities of these spots mainly because the samples from different levels of salt intake were not run on the same gel.

Hnrpk and the Abnormal Regulation of Angiotensinogen Expression in SS Rats
One of the differentially expressed proteins identified by the proteomic analysis was heterogeneous nuclear ribonucleoprotein K, encoded by the gene Hnrpk. Hnrpk has been reported to be a transcriptional factor that reduces mRNA levels of angiotensinogen.19 A role of Hnrpk in the SS model has not been reported.

Western blot analysis indicated that Hnrpk protein was significantly more abundant in the renal medulla of SS-13BN rats on the 4% NaCl diet than in SS rats (Figure 3A). In contrast, the mRNA level of angiotensinogen in the renal medulla was significantly less abundant in SS-13BN rats on the 4% NaCl diet than in SS rats (Figure 3B). Two-way ANOVA indicated significant diet-strain interactions for both Hnrpk and angiotensinogen. Hnrpk protein was not readily detectable in the renal cortex of either strain (Figure 3C).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
Figure 3. Role of Hnrpk in the local regulation of angiotensinogen expression. A, Expression levels of Hnrpk in the renal medulla were significantly higher in SS-13BN rats on the 4% NaCl diet than in SS. n=4; *P<0.05 vs SS. There were significant diet-strain interactions (2-way ANOVA). B, Angiotensinogen mRNA levels in the renal medulla were significantly lower in SS-13BN rats on the 4% NaCl diet than in SS rats. n=4; *P<0.05 vs SS. There were significant diet-strain interactions (2-way ANOVA). C, Hnrpk protein was not detectable in the renal cortex in either strain of rat on either salt diet. HK-2 cells were used as a positive control. D, A ChIP analysis showed that Hnrpk interacted with the angiotensinogen promoter in the rat renal medulla in vivo. The positive control was an input DNA sample before immunoprecipitation. The negative control was a DNA sample immunoprecipitated by nonspecific mouse IgG. The last lane was a DNA sample immunoprecipitated by a mouse anti-Hnrpk antibody. PCR was performed using primers specific to the angiotensinogen promoter. PCR products were separated in an agarose gel and visualized with Sybr Green. The size of the PCR product was {approx}300 bp. Similar results were observed in 3 independent experiments. E, siRNA significantly reduced the expression level of HNRPK, the human homolog of rat Hnrpk, in HK-2 cells. n=4; *P<0.05 vs control siRNA. F, siRNA targeting HNRPK caused an upregulation of angiotensinogen in HK-2 cells. n=4; *P<0.05 vs control siRNA.

We performed ChIP analyses in vivo and siRNA experiments in vitro to further examine the role of Hnrpk in the regulation of angiotensinogen expression. As shown in Figure 3D, the ChIP analysis showed that Hnrpk protein bound to the angiotensinogen promoter in the renal medulla in vivo. SiRNA targeting HNRPK, the human homolog of rat Hnrpk, significantly reduced the expression level of HNRPK in cultured human kidney cells (Figure 3E). The partial silencing of HNRPK resulted in a significant increase in the expression level of angiotensinogen (Figure 3F).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
up arrowResults
*Discussion
down arrowReferences
 
The differentially expressed proteins found in the present study might help identify molecular mechanisms of salt-sensitive hypertension that had not been suspected previously. Some of the differentially expressed proteins may play a causal role in the development of salt-sensitive hypertension. Particularly interesting are the proteins encoded by genes located on the substituted chromosome 13. Alternatively, the identified proteins may represent intermediate steps in a regulatory network that modulates blood pressure salt sensitivity.

One of the strengths of the present study was the use of young rats, which largely avoided secondary effects of differences in blood pressure. The treatment with the 4% NaCl diet for 3 days was used to reveal differential expression under the high-salt challenge, while still avoiding effects of different blood pressure. The use of the consomic SS-13BN rat as a control further reduced the chance of detecting molecular differences not relevant to the blood pressure salt sensitivity. Some of the identified proteins, however, might not be related to the blood pressure phenotype, because SS and SS-13BN rats may still differ in phenotypes unrelated to blood pressure salt sensitivity.

mRNA expression profiles in the renal medulla of SS and SS-13BN rats have been analyzed in previous studies that used a 1800-gene array.14,21 The only overlap between the DNA microarray studies and the proteomic analysis was Tf (transferrin), which was found to be downregulated in SS-13BN compared with SS rats. A 28 000-element cDNA microarray was recently used to in an expanded analysis of the SS model (Liang M, Lee NH, Wang H, Greene AS, Kwitek AE, Kaldunski ML, Luv TV, Frank BC, Bugenhagen S, Jacob HJ, Cowley AW Jr, unpublished data, 2008). Genes encoding 15 of the 25 renal medullary proteins identified in the 0.4% NaCl groups in the present study were represented in the 28 000-element cDNA microarray. Three of those genes, including Actb (β-actin), Serpinc1 (serine or cysteine peptidase inhibitor, clade C, member 1), and Vim (vimentin), were considered differentially expressed between SS and SS-13BN at both mRNA and protein levels. Actb was found to be more highly expressed in SS at both levels. The Serpinc1 mRNA was lower in SS rats, whereas the protein appeared higher in SS rats, although there seemed to be multiple spots of Sperinc1 protein on the gel. The Vim mRNA was higher in SS rats. Two spots of the Vim protein were identified on the gel, one being higher and the other lower in SS rats. The low level of overlap between DNA microarray and proteomic results illustrates the unique value of each approach22,23 and may be because of a number of factors. Several posttranscriptional regulatory mechanisms might be involved in the SS model, including a role of microRNA16 that might be an interesting subject for future studies. In addition, the proteomic techniques that we used preferentially detect soluble and high-abundance proteins.

The renal cortex and the renal medulla were analyzed in the present study because of the importance of the kidney in the SS phenotype. Only a small number of proteins, such as 60-kDa heat shock protein, fumarate hydratase 1, and tubulins, was identified in both kidney regions. It suggests that the 2 kidney regions might be involved in the regulation of blood pressure salt sensitivity through largely distinct pathways.24 It may be worthwhile to analyze other organ tissues in future studies, such as the adrenal glands.25

The renal cortex and the renal medulla each consists of multiple cell types. The changes we observed could result from either a change in a give protein per cell or a change in the number or size of a given cell type with respect to other cell types. Moreover, it would be difficult to detect changes that occur specifically in a minority cell type because the changes could be diluted by other cell types. It is desirable to study homogeneous cell types, although isolation of homogenous cell types is not always practical. Meanwhile, analysis of heterogeneous tissue can still be informative, especially when the disease of interest involves most cell types present in the tissue, which is likely the case with the role of the kidney in complex models of hypertension.

The SS rat is traditionally considered a low-renin model of hypertension. Local renin-angiotensin systems in the kidney, however, have been suggested to be significant in the SS model.26 The present study indicated that downregulation of Hnrpk might contribute to the abnormal elevation of angiotensinogen expression in the renal medulla in SS rats fed the 4% NaCl diet. Hnrpk is a multifunctional protein present both in and outside of the nucleus.27 Hnrpk has been shown to bind to, and inhibit the activity of, the angiotensinogen promoter.19 The present study suggested that Hnrpk could be a tissue-specific regulator of angiotensinogen expression, because Hnrpk was not detectable in the renal cortex in the rat strains we used. It would be important to investigate in future studies the functional significance of renal medullary expression of Hnrpk and angiotensinogen in SS hypertension.

Perspectives
The present study was one of the first to use proteomic approaches to study salt-sensitive hypertension. The results provided new insights into the genetic and pathophysiological mechanisms of SS hypertension. The findings may help improve the understanding of human salt-sensitive forms of hypertension.


*    Acknowledgments
 
Sources of Funding

The study was supported by National Institutes of Health grants R01 HL077263 (M.L.) and N01-HV-28182 (A.S.G.).

Disclosures

None.

Received December 20, 2007; first decision January 8, 2008; accepted January 29, 2008.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
up arrowResults
up arrowDiscussion
*References
 
1. Sullivan JM, Prewitt RL, Ratts TE. Sodium sensitivity in normotensive and borderline hypertensive humans. Am J Med Sci. 1988; 295: 370–377.[Medline] [Order article via Infotrieve]

2. Rapp JP. Dahl salt-susceptible and salt-resistant rats. A review. Hypertension. 1982; 4: 753–763.[Free Full Text]

3. Cowley AW Jr. Genetic and nongenetic determinants of salt sensitivity and blood pressure. Am J Clin Nutr. 1997; 65: 587S–593S.[Medline] [Order article via Infotrieve]

4. Dahl LK, Heine M. Primary role of renal homografts in setting chronic blood pressure levels in rats. Circ Res. 1975; 36: 692–696.[Abstract/Free Full Text]

5. Roman RJ. Abnormal renal hemodynamics and pressure-natriuresis relationship in Dahl salt-sensitive rats. Am J Physiol. 1986; 251: F57–F65.[Medline] [Order article via Infotrieve]

6. Tobian L. Salt and hypertension. Lessons from animal models that relate to human hypertension. Hypertension. 1991; 17: I52–I58.[Medline] [Order article via Infotrieve]

7. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol Rev. 2000; 80: 135–172.[Abstract/Free Full Text]

8. Stoll M, Cowley AW Jr, Tonellato PJ, Greene AS, Kaldunski ML, Roman RJ, Dumas P, Schork NJ, Wang Z, Jacob HJ. A genomic-systems biology map for cardiovascular function. Science. 2001; 294: 1723–1726.[Abstract/Free Full Text]

9. Cowley AW Jr, Liang M, Roman RJ, Greene AS, Jacob HJ. Consomic rat model systems for physiological genomics. Acta Physiol Scand. 2004; 181: 585–592.[CrossRef][Medline] [Order article via Infotrieve]

10. Cowley AW Jr. The genetic dissection of essential hypertension. Nat Rev Genet. 2006; 7: 829–740.[Medline] [Order article via Infotrieve]

11. Cowley AW Jr, Roman RJ, Kaldunski ML, Dumas P, Dickhout JG, Greene AS, Jacob HJ. Brown Norway chromosome 13 confers protection from high salt to consomic Dahl S rat. Hypertension. 2001; 37: 456–461.[Abstract/Free Full Text]

12. Taylor NE, Glocka P, Liang M, Cowley AW Jr. NADPH oxidase in the renal medulla causes oxidative stress and contributes to salt-sensitive hypertension in Dahl S rats. Hypertension. 2006; 47: 692–698.[Abstract/Free Full Text]

13. Drenjancevic-Peric I, Frisbee JC, Lombard JH. Skeletal muscle arteriolar reactivity in SS.BN13 consomic rats and Dahl salt-sensitive rats. Hypertension. 2003; 41: 1012–1015.[Abstract/Free Full Text]

14. Liang M, Yuan B, Rute E, Greene AS, Zou AP, Soares P, MCQuestion GD, Slocum GR, Jacob HJ, Cowley AW Jr. Renal medullary genes in salt-sensitive hypertension: a chromosomal substitution and cDNA microarray study. Physiol Genomics. 2002; 8: 139–149.[Abstract/Free Full Text]

15. Usa K, Singh RJ, Netzel BC, Liu Y, Raff H, Liang M. Renal interstitial corticosterone and 11-dehydrocorticosterone in conscious rats. Am J Physiol Renal Physiol. 2007; 293: F186–F192.[Abstract/Free Full Text]

16. Tian Z, Greene AS, Pietrusz JL, Matus IR, Liang M. MicroRNA-target pairs in the rat kidney identified by microRNA microarray, proteomic, and bioinformatic analysis. Genome Res. 2008 Jan 29 [Epub ahead of print].

17. Liang M, Pietrusz JL. Thiol-related genes in diabetic complications: a novel protective role for endogenous thioredoxin 2. Arterioscler Thromb Vasc Biol. 2007; 27: 77–83.[Abstract/Free Full Text]

18. Liu Y, Park F, Pietrusz JL, Jia G, Singh RJ, Netzel BC, Liang M. Suppression of 11β-hydroxysteroid dehydrogenase type 1 with RNA interference substantially attenuates 3T3-L1 adipogenesis. Physiol Genomics. 2008; 32: 343–351.[Abstract/Free Full Text]

19. Wei CC, Zhang SL, Chen YW, Guo DF, Ingelfinger JR, Bomsztyk K, Chan JS. Heterogeneous nuclear ribonucleoprotein K modulates angiotensinogen gene expression in kidney cells. J Biol Chem. 2006; 281: 25344–25355.[Abstract/Free Full Text]

20. Knoll KE, Pietrusz JL, Liang M. Tissue-specific transcriptome responses in rats with early streptozotocin-induced diabetes. Physiol Genomics. 2005; 21: 222–229.[Abstract/Free Full Text]

21. Liang M, Yuan B, Rute E, Greene AS, Olivier M, Cowley AW Jr. Insights into Dahl salt-sensitive hypertension revealed by temporal patterns of renal medullary gene expression. Physiol Genomics. 2003; 12: 229–237.[Abstract/Free Full Text]

22. Liang M, Cowley AW, Greene AS. High throughput gene expression profiling: a molecular approach to integrative physiology. J Physiol. 2004; 554: 22–30.[Abstract/Free Full Text]

23. Liang M, Cowley AW Jr, Hessner MJ, Lazar J, Basile DP, Pietrusz JL. Transcriptome analysis and kidney research: toward systems biology. Kidney Int. 2005; 67: 2114–2122.[CrossRef][Medline] [Order article via Infotrieve]

24. Cowley AW Jr. Role of the renal medulla in volume and arterial pressure regulation. Am J Physiol. 1997; 273: R1–R15.[Medline] [Order article via Infotrieve]

25. Rapp JP, Dahl LK. Adrenal steroidogenesis in rats bred for susceptibility and resistance to the hypertensive effect of salt. Endocrinology. 1971; 88: 52–65.[Abstract/Free Full Text]

26. Kobori H, Nishiyama A, Abe Y, Navar LG. Enhancement of intrarenal angiotensinogen in Dahl salt-sensitive rats on high salt diet. Hypertension. 2003; 41: 592–597.[Abstract/Free Full Text]

27. Bomsztyk K, Denisenko O, Ostrowski J. hnRNP K: one protein multiple processes. Bioessays. 2004; 26: 629–638.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
Y. Liu, D. Mladinov, J. L. Pietrusz, K. Usa, and M. Liang
Glucocorticoid response elements and 11{beta}-hydroxysteroid dehydrogenases in the regulation of endothelial nitric oxide synthase expression
Cardiovasc Res, January 1, 2009; 81(1): 140 - 147.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. Liu, R. J. Singh, K. Usa, B. C. Netzel, and M. Liang
Renal medullary 11{beta}-hydroxysteroid dehydrogenase type 1 in Dahl salt-sensitive hypertension
Physiol Genomics, December 12, 2008; 36(1): 52 - 58.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Liang, N. H. Lee, H. Wang, A. S. Greene, A. E. Kwitek, M. L. Kaldunski, T. V. Luu, B. C. Frank, S. Bugenhagen, H. J. Jacob, et al.
Molecular networks in Dahl salt-sensitive hypertension based on transcriptome analysis of a panel of consomic rats
Physiol Genomics, June 1, 2008; 34(1): 54 - 64.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
51/4/899    most recent
HYPERTENSIONAHA.107.109173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, Z.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, Z.
Right arrow Articles by Liang, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Dietary Sodium
Related Collections
Right arrow Hypertension - basic studies