| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2008;51:899.)
© 2008 American Heart Association, Inc.
Original Articles |
From the Department of Physiology (Z.T., A.S.G., K.U., J.B., J.L.P., A.W.C., M.L.), Biotechnology and Biomedical Engineering Center (Z.T., A.S.G., I.R.M.), Medical College of Wisconsin, Milwaukee; and the Department of Biomedical Engineering (Z.T.), Xian Jiaotong University, Xian, Shanxi, Peoples Republic of China.
Correspondence to Mingyu Liang, Department of Physiology, Medical College of Wisconsin, Milwaukee, WI 53226. E-mail mliang{at}mcw.edu
| Abstract |
|---|
|
|
|---|
Key Words: hypertension gene proteomics kidney angiotensin
| Introduction |
|---|
|
|
|---|
The Dahl salt-sensitive (SS) rat is a commonly used model of human salt-sensitive forms of hypertension.2,3 Alterations in a number of physiological processes have been shown to be potentially involved in the increased blood pressure salt sensitivity in the SS rat. Particularly, abnormalities in the kidneys appear to play a critical role.4–6 The molecular mechanisms involved in the development of hypertension in SS rats, however, appear to be complex. For instance, quantitative trait loci analyses have indicated that multiple regions in several chromosomes are associated with the increased blood pressure salt sensitivity in the SS rat.7,8
The rat strains commonly used as controls for SS for physiological studies may contain many genetic or molecular differences from the SS that are unrelated to the hypertension phenotype. To reduce these confounding effects, various congenic or consomic rat strains have been generated by substituting a small part of the genome from salt-resistant strains of rat into the SS.9,10 Congenic or consomic SS rats that exhibit salt resistance may serve as useful controls for studying molecular pathways in the SS model.
One of the consomic strains, SS-13BN, has become a valuable control strain for the study of the SS model. Chromosome 13 is the only chromosome in the SS-13BN rat that is of the Brown Norway origin, making SS-13BN genetically 98% identical to SS, yet the blood pressure salt sensitivity is substantially reduced.11 Several interesting physiological differences have been identified between SS-13BN and SS rats, including a reduced level of oxidative stress in the renal medulla and changes in vascular reactivity.12,13
The goal of the present study was to identify differentially expressed proteins that might contribute to the difference in blood pressure salt sensitivity between SS and SS-13BN rats. Mean arterial blood pressure is typically 15 mm Hg higher in SS rats than in SS-13BN rats at 11 to 12 weeks of age, even if the rats have been maintained on the 0.4% NaCl diet.12 Differential expression of proteins in rats at this age would include secondary effects of the difference in blood pressure. We showed that we could avoid the confounding effect of the difference in blood pressure by using 6-week–old rats. Proteomic analysis identified several dozen proteins that were differentially expressed between 6-week–old SS and SS-13BN rats fed diets containing 0.4% or 4.0% NaCl. One of the differentially expressed proteins, heterogeneous nuclear ribonucleoprotein K, was shown to possibly play a role in the strain-specific regulation of angiotensinogen expression in the renal medulla.
| Methods and Materials |
|---|
|
|
|---|
Measurement of Arterial Blood Pressure
Arterial blood pressure in conscious, freely moving rats was measured using catheters chronically implanted in the femoral artery as described previously.12,15 Rats were 5 weeks old at the time of surgery and 6 weeks old at the beginning of blood pressure measurement.
Dietary Treatment and Tissue Harvest
SS and SS-13BN rats were maintained on a purified AIN-76A rodent diet (Dyets) containing 0.4% NaCl and had free access to water. At 6 weeks of age, one half of the rats were switched to a diet containing 4% NaCl for 3 days. Kidneys were flushed in situ with cold normal saline. Renal cortex and renal medulla tissue was collected as described.14
Proteomic Analysis
Renal cortical and medullary proteomic profiles were compared between SS and SS-13BN rats (n=4) using differential in-gel electrophoresis and mass spectrometry techniques, as described previously.16 Briefly, protein samples from SS and SS-13BN rats were labeled with CyDye differential in-gel electrophoresis Fluor minimal dyes Cy3 or Cy5 (GE Healthcare), with the dyes switched between the 2 strains for every other gel. A pool of all of the samples was labeled with Cy2. Three labeled samples, including an SS, an SS-13BN, and the pool, were combined and separated by 2D gel electrophoresis. A total of 16 analytic gels were run (4 gels per comparison x2 diets x2 tissue types). The protein abundance was compared between SS and SS-13BN according to the intensity of each fluorescent dye within each spot. Criteria for differential expression were a P<0.05, a difference >1.2-fold, and the appearance of the spot in
3 of the 4 gels in a comparison. Differentially expressed protein spots were picked from preparative gels. The identities of differentially expressed proteins were obtained using mass spectrometry followed by Mascot searches.
Western Blot
Abundance of specific proteins was analyzed using Western blot as described previously.15–18 Coomassie blue staining was used to normalize the abundance of specific proteins. Antibodies for Cu-Zn containing superoxide dismutase, heterogeneous nuclear ribonucleoprotein K, and angiotensinogen were from Santa Cruz Biotechnology.
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation (ChIP) analysis was performed using the EZ ChIP kit from Upstate (Millipore) following the manufacturers instructions except for the following modifications. Renal medulla samples were rinsed with PBS and cut into 1-mm3 pieces before cross-linking. Cross-linked samples were homogenized in the lysis buffer using 10 gentle strokes. The homogenate was sonicated on ice 4 times for 10 seconds each with 10-second intervals using a sonicator (Sonic Dismembrator 60, Fisher) at setting 3. Primers for the Hnrpk binding site in the rat angiotensinogen promoter were CCTTGATGCCTCCAACAACT (forward) and GGTGGGAGCTGAGAAGACAG (reverse).19 PCR was performed for 38 cycles.
Real-Time PCR
Real-time PCR analysis using the Taqman chemistry (Applied Biosystems) was performed as described previously.15,17,18,20 Oligonucleotide sequences for rat angiotensinogen were as follows: forward GCGCCTAAAACAGCCATTTG, reverse GCAAGAACTGGGTCAGTGGATAA, probe FAM-CCCCGCCATCTTCCCTCGCT-TAMRA.
Cell Culture
HK-2, a human kidney epithelial cell line, was obtained from and cultured as suggested by American Type Culture Collection.
RNA Interference
RNA interference was performed as described previously.17,18 The small interfering RNA (siRNA) target sequence in human heterogeneous nuclear ribonucleoprotein K was AATCTGATGCTGTGGAATGCT (Qiagen). Western blot or real-time PCR analysis was performed 48 hours after transfection.
Statistics
Data were analyzed using Student t test or ANOVA followed by the Holm-Sidak test. P<0.05 was considered significant. Data are shown as means±SEMs.
| Results |
|---|
|
|
|---|
|
Differential Proteome Profiles
Proteomic profiles in the renal cortex and the renal medulla were compared between 6-week–old SS and SS-13BN rats fed the 0.4% NaCl diet or switched to the 4% NaCl diet for 3 days. A summary of the throughput of the proteomic analysis is shown in Table 1. Note that a protein might be identified in multiple spots, and changes in individual spots can occur with no change in the total amount of a given protein.
|
Differentially expressed proteins and their fold differences are reported in Tables 2 and 3![]()
. Additional information for each differentially expressed protein spot, including standardized gene name, chromosomal location, P value for the differential expression, and indexes of the confidence of protein identification is shown in Tables S1 and S2 (available online at http://hyper.ahajournals.org).
|
|
|
A representative image of 2D differential in-gel electrophoresis is shown in Figure S1. Differential expression of Cu-Zn superoxide dismutase (Sod1) and heterogeneous nuclear ribonucleoprotein K (Hnrpk) was verified by Western blotting (Figure 2).
|
The proteins differentially expressed between SS and SS-13BN rats were involved in a number of cellular functions or structures such as signal transduction, energy metabolism, and cytoskeleton. These include proteins such as heat shock proteins, transcriptional factors, mitochondrial enzymes, and tubulin components. Proteins encoded by several genes located on the substituted chromosome 13, including Actr3, Fh1, Serpinc1, and Tagln2, were found differentially expressed between SS and SS-13BN.
The emphasis of this study was on the comparison between the 2 strains. We also noticed that the changes in dietary salt intake appeared to affect >200 protein spots within each strain. We did not obtain the identities of these spots mainly because the samples from different levels of salt intake were not run on the same gel.
Hnrpk and the Abnormal Regulation of Angiotensinogen Expression in SS Rats
One of the differentially expressed proteins identified by the proteomic analysis was heterogeneous nuclear ribonucleoprotein K, encoded by the gene Hnrpk. Hnrpk has been reported to be a transcriptional factor that reduces mRNA levels of angiotensinogen.19 A role of Hnrpk in the SS model has not been reported.
Western blot analysis indicated that Hnrpk protein was significantly more abundant in the renal medulla of SS-13BN rats on the 4% NaCl diet than in SS rats (Figure 3A). In contrast, the mRNA level of angiotensinogen in the renal medulla was significantly less abundant in SS-13BN rats on the 4% NaCl diet than in SS rats (Figure 3B). Two-way ANOVA indicated significant diet-strain interactions for both Hnrpk and angiotensinogen. Hnrpk protein was not readily detectable in the renal cortex of either strain (Figure 3C).
|
We performed ChIP analyses in vivo and siRNA experiments in vitro to further examine the role of Hnrpk in the regulation of angiotensinogen expression. As shown in Figure 3D, the ChIP analysis showed that Hnrpk protein bound to the angiotensinogen promoter in the renal medulla in vivo. SiRNA targeting HNRPK, the human homolog of rat Hnrpk, significantly reduced the expression level of HNRPK in cultured human kidney cells (Figure 3E). The partial silencing of HNRPK resulted in a significant increase in the expression level of angiotensinogen (Figure 3F).
| Discussion |
|---|
|
|
|---|
One of the strengths of the present study was the use of young rats, which largely avoided secondary effects of differences in blood pressure. The treatment with the 4% NaCl diet for 3 days was used to reveal differential expression under the high-salt challenge, while still avoiding effects of different blood pressure. The use of the consomic SS-13BN rat as a control further reduced the chance of detecting molecular differences not relevant to the blood pressure salt sensitivity. Some of the identified proteins, however, might not be related to the blood pressure phenotype, because SS and SS-13BN rats may still differ in phenotypes unrelated to blood pressure salt sensitivity.
mRNA expression profiles in the renal medulla of SS and SS-13BN rats have been analyzed in previous studies that used a 1800-gene array.14,21 The only overlap between the DNA microarray studies and the proteomic analysis was Tf (transferrin), which was found to be downregulated in SS-13BN compared with SS rats. A 28 000-element cDNA microarray was recently used to in an expanded analysis of the SS model (Liang M, Lee NH, Wang H, Greene AS, Kwitek AE, Kaldunski ML, Luv TV, Frank BC, Bugenhagen S, Jacob HJ, Cowley AW Jr, unpublished data, 2008). Genes encoding 15 of the 25 renal medullary proteins identified in the 0.4% NaCl groups in the present study were represented in the 28 000-element cDNA microarray. Three of those genes, including Actb (β-actin), Serpinc1 (serine or cysteine peptidase inhibitor, clade C, member 1), and Vim (vimentin), were considered differentially expressed between SS and SS-13BN at both mRNA and protein levels. Actb was found to be more highly expressed in SS at both levels. The Serpinc1 mRNA was lower in SS rats, whereas the protein appeared higher in SS rats, although there seemed to be multiple spots of Sperinc1 protein on the gel. The Vim mRNA was higher in SS rats. Two spots of the Vim protein were identified on the gel, one being higher and the other lower in SS rats. The low level of overlap between DNA microarray and proteomic results illustrates the unique value of each approach22,23 and may be because of a number of factors. Several posttranscriptional regulatory mechanisms might be involved in the SS model, including a role of microRNA16 that might be an interesting subject for future studies. In addition, the proteomic techniques that we used preferentially detect soluble and high-abundance proteins.
The renal cortex and the renal medulla were analyzed in the present study because of the importance of the kidney in the SS phenotype. Only a small number of proteins, such as 60-kDa heat shock protein, fumarate hydratase 1, and tubulins, was identified in both kidney regions. It suggests that the 2 kidney regions might be involved in the regulation of blood pressure salt sensitivity through largely distinct pathways.24 It may be worthwhile to analyze other organ tissues in future studies, such as the adrenal glands.25
The renal cortex and the renal medulla each consists of multiple cell types. The changes we observed could result from either a change in a give protein per cell or a change in the number or size of a given cell type with respect to other cell types. Moreover, it would be difficult to detect changes that occur specifically in a minority cell type because the changes could be diluted by other cell types. It is desirable to study homogeneous cell types, although isolation of homogenous cell types is not always practical. Meanwhile, analysis of heterogeneous tissue can still be informative, especially when the disease of interest involves most cell types present in the tissue, which is likely the case with the role of the kidney in complex models of hypertension.
The SS rat is traditionally considered a low-renin model of hypertension. Local renin-angiotensin systems in the kidney, however, have been suggested to be significant in the SS model.26 The present study indicated that downregulation of Hnrpk might contribute to the abnormal elevation of angiotensinogen expression in the renal medulla in SS rats fed the 4% NaCl diet. Hnrpk is a multifunctional protein present both in and outside of the nucleus.27 Hnrpk has been shown to bind to, and inhibit the activity of, the angiotensinogen promoter.19 The present study suggested that Hnrpk could be a tissue-specific regulator of angiotensinogen expression, because Hnrpk was not detectable in the renal cortex in the rat strains we used. It would be important to investigate in future studies the functional significance of renal medullary expression of Hnrpk and angiotensinogen in SS hypertension.
Perspectives
The present study was one of the first to use proteomic approaches to study salt-sensitive hypertension. The results provided new insights into the genetic and pathophysiological mechanisms of SS hypertension. The findings may help improve the understanding of human salt-sensitive forms of hypertension.
| Acknowledgments |
|---|
The study was supported by National Institutes of Health grants R01 HL077263 (M.L.) and N01-HV-28182 (A.S.G.).
Disclosures
None.
Received December 20, 2007; first decision January 8, 2008; accepted January 29, 2008.
| References |
|---|
|
|
|---|
2. Rapp JP. Dahl salt-susceptible and salt-resistant rats. A review. Hypertension. 1982; 4: 753–763.
3. Cowley AW Jr. Genetic and nongenetic determinants of salt sensitivity and blood pressure. Am J Clin Nutr. 1997; 65: 587S–593S.[Medline] [Order article via Infotrieve]
4. Dahl LK, Heine M. Primary role of renal homografts in setting chronic blood pressure levels in rats. Circ Res. 1975; 36: 692–696.
5. Roman RJ. Abnormal renal hemodynamics and pressure-natriuresis relationship in Dahl salt-sensitive rats. Am J Physiol. 1986; 251: F57–F65.[Medline] [Order article via Infotrieve]
6. Tobian L. Salt and hypertension. Lessons from animal models that relate to human hypertension. Hypertension. 1991; 17: I52–I58.[Medline] [Order article via Infotrieve]
7. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol Rev. 2000; 80: 135–172.
8. Stoll M, Cowley AW Jr, Tonellato PJ, Greene AS, Kaldunski ML, Roman RJ, Dumas P, Schork NJ, Wang Z, Jacob HJ. A genomic-systems biology map for cardiovascular function. Science. 2001; 294: 1723–1726.
9. Cowley AW Jr, Liang M, Roman RJ, Greene AS, Jacob HJ. Consomic rat model systems for physiological genomics. Acta Physiol Scand. 2004; 181: 585–592.[CrossRef][Medline] [Order article via Infotrieve]
10. Cowley AW Jr. The genetic dissection of essential hypertension. Nat Rev Genet. 2006; 7: 829–740.[Medline] [Order article via Infotrieve]
11. Cowley AW Jr, Roman RJ, Kaldunski ML, Dumas P, Dickhout JG, Greene AS, Jacob HJ. Brown Norway chromosome 13 confers protection from high salt to consomic Dahl S rat. Hypertension. 2001; 37: 456–461.
12. Taylor NE, Glocka P, Liang M, Cowley AW Jr. NADPH oxidase in the renal medulla causes oxidative stress and contributes to salt-sensitive hypertension in Dahl S rats. Hypertension. 2006; 47: 692–698.
13. Drenjancevic-Peric I, Frisbee JC, Lombard JH. Skeletal muscle arteriolar reactivity in SS.BN13 consomic rats and Dahl salt-sensitive rats. Hypertension. 2003; 41: 1012–1015.
14. Liang M, Yuan B, Rute E, Greene AS, Zou AP, Soares P, MCQuestion GD, Slocum GR, Jacob HJ, Cowley AW Jr. Renal medullary genes in salt-sensitive hypertension: a chromosomal substitution and cDNA microarray study. Physiol Genomics. 2002; 8: 139–149.
15. Usa K, Singh RJ, Netzel BC, Liu Y, Raff H, Liang M. Renal interstitial corticosterone and 11-dehydrocorticosterone in conscious rats. Am J Physiol Renal Physiol. 2007; 293: F186–F192.
16. Tian Z, Greene AS, Pietrusz JL, Matus IR, Liang M. MicroRNA-target pairs in the rat kidney identified by microRNA microarray, proteomic, and bioinformatic analysis. Genome Res. 2008 Jan 29 [Epub ahead of print].
17. Liang M, Pietrusz JL. Thiol-related genes in diabetic complications: a novel protective role for endogenous thioredoxin 2. Arterioscler Thromb Vasc Biol. 2007; 27: 77–83.
18. Liu Y, Park F, Pietrusz JL, Jia G, Singh RJ, Netzel BC, Liang M. Suppression of 11β-hydroxysteroid dehydrogenase type 1 with RNA interference substantially attenuates 3T3-L1 adipogenesis. Physiol Genomics. 2008; 32: 343–351.
19. Wei CC, Zhang SL, Chen YW, Guo DF, Ingelfinger JR, Bomsztyk K, Chan JS. Heterogeneous nuclear ribonucleoprotein K modulates angiotensinogen gene expression in kidney cells. J Biol Chem. 2006; 281: 25344–25355.
20. Knoll KE, Pietrusz JL, Liang M. Tissue-specific transcriptome responses in rats with early streptozotocin-induced diabetes. Physiol Genomics. 2005; 21: 222–229.
21. Liang M, Yuan B, Rute E, Greene AS, Olivier M, Cowley AW Jr. Insights into Dahl salt-sensitive hypertension revealed by temporal patterns of renal medullary gene expression. Physiol Genomics. 2003; 12: 229–237.
22. Liang M, Cowley AW, Greene AS. High throughput gene expression profiling: a molecular approach to integrative physiology. J Physiol. 2004; 554: 22–30.
23. Liang M, Cowley AW Jr, Hessner MJ, Lazar J, Basile DP, Pietrusz JL. Transcriptome analysis and kidney research: toward systems biology. Kidney Int. 2005; 67: 2114–2122.[CrossRef][Medline] [Order article via Infotrieve]
24. Cowley AW Jr. Role of the renal medulla in volume and arterial pressure regulation. Am J Physiol. 1997; 273: R1–R15.[Medline] [Order article via Infotrieve]
25. Rapp JP, Dahl LK. Adrenal steroidogenesis in rats bred for susceptibility and resistance to the hypertensive effect of salt. Endocrinology. 1971; 88: 52–65.
26. Kobori H, Nishiyama A, Abe Y, Navar LG. Enhancement of intrarenal angiotensinogen in Dahl salt-sensitive rats on high salt diet. Hypertension. 2003; 41: 592–597.
27. Bomsztyk K, Denisenko O, Ostrowski J. hnRNP K: one protein multiple processes. Bioessays. 2004; 26: 629–638.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
Y. Liu, D. Mladinov, J. L. Pietrusz, K. Usa, and M. Liang Glucocorticoid response elements and 11{beta}-hydroxysteroid dehydrogenases in the regulation of endothelial nitric oxide synthase expression Cardiovasc Res, January 1, 2009; 81(1): 140 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, R. J. Singh, K. Usa, B. C. Netzel, and M. Liang Renal medullary 11{beta}-hydroxysteroid dehydrogenase type 1 in Dahl salt-sensitive hypertension Physiol Genomics, December 12, 2008; 36(1): 52 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Liang, N. H. Lee, H. Wang, A. S. Greene, A. E. Kwitek, M. L. Kaldunski, T. V. Luu, B. C. Frank, S. Bugenhagen, H. J. Jacob, et al. Molecular networks in Dahl salt-sensitive hypertension based on transcriptome analysis of a panel of consomic rats Physiol Genomics, June 1, 2008; 34(1): 54 - 64. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |