Published online before print September 29, 2008, doi: 10.1161/HYPERTENSIONAHA.108.114801
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2008;52:910.)
© 2008 American Heart Association, Inc.
Original Articles |
Interaction Among Heme Oxygenase, Nuclear Factor-
B, and Transcription Activating Factors in Cardiac Hypertrophy in Hypertension
From the Departments of Physiology (A.J., J.M.N.) and Pathology and Laboratory Medicine (E.T.), College of Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.
Correspondence to Joseph Fomusi Ndisang, Department of Physiology, University of Saskatchewan College of Medicine, 107 Wiggins Rd, Saskatoon, Saskatchewan, Canada S7N 5E5. E-mail jon056{at}mail.usask.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Deoxycorticosterone acetate–induced hypertension is a volume overload and human primary aldosteronism model characterized by severe cardiac lesions attributed to elevated inflammation, oxidative stress, fibrosis, and hypertrophy. An important cytoprotective pathway that counteracts tissue insults is the heme oxygenase (HO) system. Although the HO-1 gene promoter contains consensus binding sites for proinflammatory/oxidative transcription factors like nuclear factor-
B, activating protein (AP)-1, and AP-2, the effects of HO inducers on these transcription factors in cardiac lesions of deoxycorticosterone acetate hypertension are not fully understood. Hemin therapy normalized systolic blood pressure and markedly reduced the left:right ventricular ratio, left ventricular wall thickness, and left ventricle:body weight ratio, whereas the HO blocker, chromium mesoporphyrin, exacerbated cardiac fibrosis/hypertrophy in deoxycorticosterone acetate–hypertensive rats. The cardioprotection by hemin was accompanied by increased HO-1, HO activity, cGMP, superoxide dismutase, catalase, the total antioxidant capacity alongside the reduction of 8-isoprostane, AP-1, AP-2, nuclear factor-B, and c-Jun-NH2-terminal kinase, whereas chromium mesoporphyrin abolished the hemin effects. Furthermore, hemin therapy attenuated transforming growth factor-β1 and extracellular matrix proteins like fibronectin and collagen, with a corresponding reduction of histopathologic lesions, including longitudinal/cross-sectional muscle fiber thickness, scarring, muscular hypertrophy, coronary arteriolar thickening, and collagen deposition. The suppression of AP-1, AP-2, nuclear factor-B, and c-Jun-NH2-terminal kinase proinflammatory/oxidative mediators in the left ventricle of hemin-treated animals is a novel observation that may account for cardioprotection in deoxycorticosterone acetate hypertension. By concomitantly upregulating HO activity and cGMP and potentiating the total antioxidant status, hemin therapy reduced hypertension, suppressed oxidative stress, and attenuated extracellular matrix and remodeling proteins, with a reduction of histopathologic lesions that characterize cardiac fibrosis, hypertrophy, and end-stage organ damage.
Key Words: deoxycorticosterone acetate hypertension • heme oxygenase-1 • hemin • cardiac hypertrophy • activating protein-1 • nuclear factor B • TGF-β
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Aldosterone induces inflammation, oxidative stress, and fibrosis by stimulating nuclear factor-
B (NF-B), activating protein (AP), and c-Jun-NH2-terminal kinase (JNK).1,2 In mineralocorticoid-induced hypertension, the activation of JNK, TGF-β (TGF-β1) and NF-B constitutes a potent prohypertrophic/remodeling axis.2–5 The pathophysiological role of aldosterone in cardiac damage is evident in deoxycorticosterone acetate-salt (DOCA-salt) hypertension,6 where elevated superoxide quenches NO to form peroxynitrite and 8-isoprostane, with subsequent stimulation of endothelin-1 to potentiate oxidative injury.7,8 Moreover, in DOCA-salt hypertension, locally produced aldosterone in cardiac tissue3 stimulates TGF-β1, fibronectin, and collagen-1 causing fibrosis and hypertrophy.4 Because the TGF-β1 gene promoter contains binding sites for NF-B and AP-1,5 cross-talk among TGF-β1, NF-B, and AP-1 is envisaged. Thus, the activation of TGF-β1, fibronectin, NF-B, AP-1, and JNK may constitute a potent destructive force in hypertension.
Among the physiological mechanisms triggered to counteract tissue insult is the heme oxygenase (HO) system.9–11 HO is a microsomal enzyme that breaks down the pro-oxidant heme to generate cytoprotective products such as carbon monoxide, bilirubin, biliverdin, and ferritin with effects against apoptosis, inflammation, and oxidative stress, as well as with lower blood pressure (BP).9–12 Among the HO isoforms, HO-1 is inducible and can be pharmacologically modulated by HO inducers and blockers, whereas HO-2 is constitutively expressed.12 Given the presence of consensus-binding sites for NF-B, AP-1, and AP-2 on the HO-1 gene promoter,13 the HO system may regulate these oxidative/proinflammatory transcription factors during cellular defense.13 However, the effects of the HO system on left ventricular hypertrophy in DOCA hypertension have not been fully characterized. Importantly, the multifaceted interactions among the HO system, NF-B, AP-1, and AP-2 in cardiac histopathologic lesions, such as collagen deposition, scarring, muscular hypertrophy, longitudinal/transverse muscle fiber thickness, and remodeling of coronary arterioles, have not been reported. Thus, this study unveils novel mechanisms by which the HO system alleviates cardiac damage in DOCA hypertension, a model of volume overload and human primary aldosteronism.6
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Extended methodology is available in the data supplement, available at http://hyper.ahajournals.org.
Animal Treatment and Biochemical Assays
Our experimental protocol was approved by the University of Saskatchewan Standing Committee on Animal Care and Research Ethics. Male Sprague-Dawley rats (SD) of age 8 weeks were purchased from Charles River Laboratories (Willington, Mass), housed at 21°C with 12-hour light/dark cycles, fed with standard laboratory chow, and given access to drinking water ad libitum. After a week of acclimatization, DOCA-salt hypertension was induced as described previously.14 Our experimental design included 6 groups: controls (surgery-free or normal SD, uninephrectomized [UnX]-sham, UnX-salt [0.9% NaCl+0.2% KCl] and UnX-DOCA); DOCA-salt hypertension; hemin+DOCA-salt; hemin+chromium mesoporphyrin (CrMP)+DOCA-salt; CrMP+DOCA-salt; and vehicle+ DOCA-salt. Hemin (30 mg/kg IP) was used to induce HO-1, whereas the HO blocker, CrMP (4 µmol/kg IP) was administered with or without hemin to ascertain the implication of HO. Hemin (Sigma) and CrMP (Porphyrin Products) were dissolved in 0.1 mol/L of NaOH, titrated to pH 7.4 with 0.1 mol/L of HCl, and diluted 1:10 with phosphate buffer, as we reported previously.14,15 The injection of hemin, CrMP, or vehicle began after the animals were hypertensive (196.2±2.4 mm Hg). Each injection was 0.5 mL and was given daily for 4 weeks. Although many HO inhibitors are nonspecific and affects other hemo enzymes or even increase HO-1, CrMP is selective against HO at a dose of 4 µmol/kg.15,16 Systolic BP was determined weekly in conscious animals by a standard tail-cuff noninvasive method (model 29-SSP, Harvard Apparatus). Before sacrifice, the animals were placed in metabolic cages for 24-hour urine collection. After anesthesia with pentobarbital sodium (50 mg/kg), the heart was isolated, cleaned, and weighed using an analytic balance (Precisa Instruments Ltd). Left-ventricular hypertrophy was assessed by left:right ventricular ratio, left-ventricular wall thickness, and left-ventricular body weight index after removing the atria and the right ventricle free wall separated from the left ventricle, including the septum, as described previously.17
Left-ventricular HO activity was evaluated spectrophotometrically as bilirubin production using our established method,14,15,18 whereas HO-1 concentration was evaluated by ELISA (Stressgen-Assay Design) and heme by Quantichrom Heme Assay kit (BioAssay Systems). Other biochemical parameters, including urinary/left-ventricular 8-isoprostane, a noninvasive index of oxidative stress,19 left-ventricular superoxide dismutase (SOD) activity (total), catalase activity, cGMP, and total antioxidant capacity, were measured by EIA (Cayman Chemical).14
Histological and Morphological Analyses of the Left Ventricle
The left ventricle was fixed, processed, and paraffin embedded. Sections of 5 µm were cut and stained with hematoxylin and eosin for histological analysis. Masson’s trichrome staining detected left-ventricular collagen deposition. Morphological evaluation of muscular hypertrophy and scarring was blindly done using light microscopy semiquantitatively with 0 to 2 scales (0, normal or almost normal; 1, mild; and 2, severe lesion) in each tissue section, and the mean score was calculated per group.20 Morphometric assessment of the left ventricular myocyte width (longitudinal/cross-sectional) was done randomly in 
20 muscle fibers from each tissue using NIS-elements BR-Qimaging software (0.95 µm/pixel). Morphometric analyses revealed the media:lumen ratio and media thickness/cross-sectional area of coronary arterioles of the left ventricle.
Total RNA Isolation and Quantitative RT-PCR for p65-NF-B, AP-1, AP-2, and JNK
The left ventricle was homogenized and quantitative RT-PCR done as we reported previously.14 Briefly, triplicate samples of 1 µL of cDNA each were run using a template of 3.2 pmol of primers for NF-B (forward, 5'CATGCGTTTCCGTTACAAGTGCGA-3' and reverse, 5'TGGGTGCGTCTTAGTGGTATCTGT-3'), AP-1 (forward, 5'AGCAGATGCTTGAGTTGAGAGCCA3' and reverse, 5'TTCCATGGGTCCCTGCTTTGAGAT-3'), AP-2 (forward, 5'TAAAGTGGGATCGAGGAGGCCAGAAA-3' and reverse, 5'AGTCACAAAGACTCCAAGAGGGCA-3'), JNK (forward, 5'AAGCAGCAAGGCTACTCCTTCTCA-3' and reverse, 5'ATCGAGACTGCTGTCTGTGTCTGA-3'), and GAPDH (forward, 5'AGCAAGGATACTGAGAGCAAGA-3' and reverse, 5'TCTGGGATGGAATTGTGAGGGAGA-3') in a final volume of 25 µL. Sequences of all of the primers were confirmed by the National Research Institute of Canada, Saskatoon.
Western Immunoblotting
The left ventricular tissue was homogenized and centrifuged, as described previously.14 Primary antibodies (Santa Cruz Biotechnology) fibronectin (sc-18825), TGF-β1/2/3 (sc-7892; with molecular weights for TGF-β1, TGF-β2, and TGF-β3 being 12.5, 13.0, and 12.5 kDa, respectively), and collagen-1 (sc-25974) were used. Densitometric analysis was done with UN-SCAN-IT software (Silk Scientific). The GAPDH antibody was used as a control to ascertain equivalent loading.
Statistical Analysis
All of the data were expressed as means±SEMs and analyzed by ANOVA in conjunction with the Bonferroni test for multiple comparisons. In addition, Spearman analyses, Pearson’s R analyses, and linear-by-linear association analyses were used to compare the multiple variables. Group differences at the level of P<0.05 were considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Hemin Regimen Suppressed Left Ventricular Hypertrophy in DOCA-Salt Rats
The application of DOCA strips to UnX rats induced severe hypertension (196.2±2.4 mm Hg), whereas the controls (normal SD, sham-operated [UnX-sham], UnX-salt, and UnX-DOCA) remained normotensive. Administering hemin to DOCA-salt hypertensive rats lowered BP to physiological levels (196.2±2.4 versus 132.8±1.6 mm Hg; n=26; P<0.01), whereas hemin+CrMP or CrMP alone nullified the hemin effect and exacerbated hypertension (Table S1), suggesting an important role of basal HO activity in BP regulation. The vehicle had no effect on systolic BP. At the end of first week, BP dropped from 196.2±2.4 to 178.3±2.8 mm Hg and progressively decreased after the second, third, and fourth weeks to 165.2±2.3, 148.5±2.4, and 132.8±1.6 mm Hg, respectively. The BP-lowering effect of hemin was accompanied by significant reduction in important indices of hypertrophy,21,22 including left ventricle:body weight ratio (Figure 1A), left:right ventricular ratio (Figure 1B), and left ventricular wall thickness (Figure 1C). Correspondingly, cardiac hypertrophy (entire heart; 3.76±0.11 versus 3.39±0.07 g/kg of body weight; n=26; P<0.01) was attenuated (Table S1), whereas the HO blocker, CrMP, exacerbated hypertrophy. These indices were abated by hemin. It is important to note that the left ventricular:body weight ratio and left:right ventricular ratio were restored to control values, whereas the left-ventricular wall thickness was reduced by 32.4%.
|
P<0.01 vs DOCA-salt). Bars represent means±SEs.Our results also indicate that hemin or CrMP alone did not significantly affect body weight, although there was a slight decrease. However, coapplication of hemin and CrMP decreased body weight (Table S1). Similarly, hemin reduced the elevated hematocrit in DOCA-salt hypertension to the levels of the control.
Hemin Upregulates HO-1, HO Activity, and cGMP but Depletes Heme and 8-Isoprostane
To understand the mechanisms underlying the cardioprotective effects of hemin, we assayed HO-1 and HO activity. The basal HO-1 and HO activity in the controls were comparable but lower than the levels of DOCA-salt–hypertensive rats. Hemin increased HO-1 and HO activity in DOCA-salt–hypertensive rats by 4.2- and 4.6-fold, respectively (Figure 2A and 2B), whereas the HO inhibitor, CrMP, nullified the effect of hemin. The enhanced HO activity would increase endogenous carbon monoxide production that would, in turn, stimulate cGMP.15 Accordingly, we detected a 2-fold increase of cGMP in hemin-treated animals, that was abolished by CrMP (Figure 2C). Our results also indicate that cGMP in the controls was comparable with untreated DOCA-salt rats. Although the basal HO activity in DOCA-salt–hypertensive rats was higher than in the controls, the magnitude might have fallen below the threshold necessary to trigger an increase in cGMP content. A similar observation has been reported previously in spontaneously hypertensive rats.15 The enhanced HO activity in hemin-treated animals was also accompanied by significant depletion of heme, a pro-oxidant, whereas CrMP increased heme levels (Figure 2D).
|
The effect of hemin on oxidative stress was evaluated by measuring urinary and cardiac 8-isoprostane, an index of oxidative stress.19,23 Although urinary 8-isoprostane gives the overall status of oxidative stress, left ventricular 8-isoprostane reflects tissue-specific oxidative stress.23 In DOCA-salt–hypertensive rats, the levels of urinary/left-ventricular 8-isoprostane were increased by 7.5- and 4-fold, respectively (Figure 2E and 2F). Interestingly, the attenuation of left ventricular hypertrophy coincided with a 3.7- and 2.6-fold reduction of urinary and left-ventricular 8-isoprostane, respectively. In contrast, CrMP nullified the effect of hemin and increased urinary/left-ventricular 8-isoprostane (Figure 2E and 2F). Although hemin markedly reduced 8-isoprostane, it did not reinstate control values. The reason for this remains unclear and needs further investigation.
Effect of Hemin Therapy on SOD, Catalase, and Overall Antioxidant Status
Because the HO system is known to potentiate antioxidants,24 we investigated the effect of hemin on catalase and SOD activities. The basal levels of catalase and SOD in DOCA-salt–hypertensive rats were significantly lower than the controls (Figure S1A and S1B). However, hemin therapy greatly enhanced catalase and SOD activities by 2.5- and 2.9-fold, with corresponding increases in the total antioxidant capacity (Figure S1C). Contrarily, the HO blocker CrMP annulled the effects of hemin.
Effect of Hemin on Oxidative/Inflammatory Mediators NF-B (p65), AP-1, AP-2, and JNK
NF-B, AP-1, and AP-2 are among the modulators of oxidative/inflammatory insults.1,13,25,26 Our results indicate that the basal NF-B mRNA expressions in sham-operated and SD controls were comparable, whereas the levels in DOCA-salt–hypertensive rats were elevated by 3.2-fold (Figure 3A). Interestingly, hemin therapy reduced NF-B by 87.1%, whereas CrMP enhanced it. Our results also indicate that the basal mRNA levels of AP-1 and AP-2 were 4.1- and 3.9-fold higher than in the controls (Figure 3B and 3C), and were abated by hemin but augmented by CrMP. Importantly, hemin reinstated control levels of AP-2, whereas a 50.9% reduction of AP-1 was observed. The reason for this selective effect is unclear and needs further study.
|
P<0.01 vs DOCA-salt+hemin or DOCA-salt+hemin+CrMP). Bars represent means±SEs; n=6 rats per group.
Given that the NF-B receptor activates AP-1 and JNK5,27 during oxidative injury, we investigated whether the modulation of NF-B by the HO system would, in turn, affect JNK. Our results indicate that the basal levels of JNK in DOCA-salt hypertensive rats, which were higher than in the controls, were significantly reduced by 49.1% by hemin but enhanced by CrMP (Figure 3D).
Although hemin therapy greatly potentiated the antioxidant status and reduced oxidative stress in DOCA-hypertensive rats, the levels of NF-B, AP-1, and JNK were not restored to the control values (Figure 3A, 3B, and 3D). Nevertheless, in hemin-treated animals, a reduction of magnitude of 87.1%, 50.9%, and 49.1% in NF-B, AP-1, and JNK, respectively, would contribute, at least in part, to the suppression of oxidative stress, fibrosis, cardiac lesions, and hypertrophy in DOCA-salt–hypertensive rats.
Hemin Therapy Reduced Left-Ventricular Histopathologic Lesions and Extracellular Matrix/Remodeling Proteins
Microscopic examinations of histological sections of the left ventricle from the different experimental groups were highly distinguishable. In the sham-operated group, cardiac muscle fibers were relatively uniform in the cross-sectional area, with little interstitial connective tissue (Figure 4A), whereas cardiac muscles from the DOCA-salt–hypertensive group had marked interstitial fibrosis and scarring distributed irregularly. The scarred areas contained muscle fibers with distinct variation in the cross-sectional area, with focal crowding and grouping of capillaries, which may be indicative of muscle fiber loss (Figure 4A). Similarly, collagen deposition in DOCA-hypertensive animals was very intense and highly diffused in the interstitium as compared with the sham-operated animals. Interestingly, hemin therapy greatly reduced scarring, collagen deposition, and longitudinal and cross-sectional muscle fiber thickness (Figure 4A).
|
These observations were further confirmed by morphometric and semiquantitative analyses. Morphometric analyses indicated that longitudinal/cross-sectional muscle fiber thickness in DOCA-salt–hypertensive rats was significantly greater than in the sham-operated control but was reduced by hemin (Figure 4B and 4C). Similarly, semiquantitative analyses indicated that hemin therapy significantly abated scarring and muscular hypertrophy in DOCA-salt–hypertensive rats (Figure 4D and 4E). It is worth noting that hemin therapy effectively restored longitudinal muscle fiber thickness and muscular hypertrophy to control levels but reduced cross-sectional muscle fiber thickness and scarring by 81.1% and 85.7%, respectively (Figure 4C and 4D). The reasons for this selective effect remain unclear and needs further investigation.
Our results also reveal that the attenuation of histopathologic lesions in DOCA-salt hypertensive rats was accompanied by reduced expressions of remodeling and extracellular matrix proteins. Accordingly, Western immunoblotting and relative densitometric analyses revealed that hemin markedly reduced TGF-β1 and reinstated controls levels (Figure 4F). Because TGF-β1 stimulates cell proliferation and regulates the synthesis of the extracellular matrix components like fibronectin and collagen-1,4 we assayed and detected that collagen-1 and fibronectin were significantly elevated in DOCA-salt–hypertensive rats (Figure 4G and 4H) but were reduced by hemin. However, hemin effectively restored fibronectin to control levels, whereas collagen type-1 was reduced by 52.4%. The reason for this selective effect remains unclear and should be investigated. Furthermore, histological and morphometric data indicated that hemin abated coronary-arteriolar thickness (Figure S2A and S2B).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cardiovascular impairment in DOCA hypertension mimics end-stage organ damage.6 In this model, structural changes lead to the development of left ventricular hypertrophy characterized by increased wall thickness, thickening of the small arteriolar coronaries, increased interstitial and perivascular collagen deposition, and elevated oxidative stress.6 Accordingly, the high levels of 8-isoprostane alongside increased NF-
B, AP-1, AP-2, and JNK observed in DOCA-hypertensive rats may act in concert with elevated TGF-β1, fibronectin, and collagen-1 to accentuate the oxidative and fibrotic destruction of cardiac tissues.3–5,7 Interestingly, upregulating the HO system abated these destructive factors and attenuated cardiac lesions, whereas the HO inhibitor, CrMP, exacerbated cardiac hypertrophy. Although many HO inhibitors are nonspecific, CrMP given at a dose of 4 µmol/kg is selective against HO.15,16 Therefore, the elevation of BP and exacerbation of cardiac lesions in CrMP-treated animals could be ascribed to the suppression HO activity in CrMP-treated animals. Moreover, we had reported previously on the important contribution of the basal HO in BP regulation.15
Many studies have underscored the cytoprotective effects of the HO system.9–11 By breaking down the pro-oxidant, heme, HO inducers reduce oxidative stress10 and heme toxicity.28 Interestingly, in hemin-treated animals, the suppression of heme was accompanied by reduced 8-isoprostane, NF-B, JNK, and AP-1, with a corresponding increase of SOD, catalase, and the potentiation of the total antioxidant status, thus suggesting reduced oxidative stress. The additive effect of the different antioxidants provides greater protection.9–11,29 The hemin-dependent increases of SOD and catalase are consistent with previous reports.24 Similarly, the suppression of JNK by the HO system agrees with previous reports showing that upregulating HO-1 inhibits oxidant-induced activation of JNK and other mitogen-activated protein kinases.30 Moreover, products from the HO system, including bilirubin, biliverdin, ferritin, and carbon monoxide, constitute a potent protective tetrad against inflammation, oxidative stress, and apoptosis.9–11,14 Another important observation is the restoration of hematocrit to control levels. Elevated hematocrit in DOCA hypertension may increase circulating heme and, thus, increase oxidative stress10 and heme toxicity,28 because the degradation of erythrocytes produces heme. Accordingly, the normalization of hematocrit may be beneficial; however, this should be further investigated.
Our studies also demonstrate the antifibrogenic effect of hemin. The reduction of interstitium collagen deposition and the corresponding decline in TGF-β1, fibronectin, and collagen-1 may account for the attenuation of fibrosis. Because TGF-β1 activates fibronectin and collagen-1,31–33 the HO system may be critical for the regulation of fibrotic events mediated by TGF-β1, fibronectin, and collagen-1. The profibrotic effect of TGF-β1 is complex, and other factors, including NF-B and AP-1, may be implicated. The availability of binding sites for NF-B and AP-1 in the TGF-β1 promoter5 suggests an intricate interaction between these pathways. Similarly, the presence of consensus binding sites for NF-B, AP-1, and AP-2 on the HO-1 promoter suggests greater interaction between these transcription factors and the HO system. Supportive of this notion are reports indicating that blockade of the HO system led to increased levels of NF-B and AP-1, with subsequent elevation of inflammation.34 Nevertheless, further investigations are needed to fully characterize the interaction between HO-1 and these pathways.
Generally, cardiac dysfunction and ventricular arrhythmias are closely linked with fibrosis, hypertrophy, and collagen deposition.6 There are 2 types of cardiac fibrosis, reactive (interstitial/perivascular) and reparative (scarring followed by necrosis),25 which manifest in DOCA hypertension. Because inflammation stimulates fibrosis,6 the concomitant attenuation of NF-B, AP-1, and AP-2 alongside the reduction of collagen deposition/collagen-1 in hemin-treated animals may attenuate the infiltration of inflammatory cells/mediators into interstitial and scarred tissue. Because cardiac fibrosis is difficult to study in human patients, other than its therapeutic relevance, our findings may have diagnostic implications, because the DOCA-salt model displays distinct fibrotic characteristics.6
Although the HO system is cytoprotective,9–11 some reports indicate that carbon monoxide may interfere with NO-induced vasodilation,35 causing endothelium-dependent vasoconstriction.36 These studies suggest that carbon monoxide may have a biphasic effect, and, therefore, the specific conditions under which different experiments are done may be critical to the observed effect. In our setting, pharmacologically administered hemin potentiated the HO system, which may, in turn, increase endogenous carbon monoxide alongside bilirubin and ferritin that act in concert to reduce hypertension, oxidative stress, and inflammation by enhancing cGMP while abating NF-B, AP-1, and AP-2.
Collectively, our results highlight the multifaceted interaction among the HO system, oxidative mediators, and extracellular matrix/remodeling proteins and suggest that the suppression of these factors may account for the reduction of cardiac fibrosis and hypertrophy in DOCA hypertension.
Perspectives
The mechanisms by which hemin suppresses cardiac hypertrophy in DOCA hypertension are complex and not fully understood (please see the data supplement). For more comprehensive knowledge, further studies examining the pharmacokinetics and pharmacodynamics of hemin would be needed to characterize the half-life, metabolites, distribution, and interaction with active proteins in a biological milieu. These are among the numerous challenges that obscure the horizon. Addressing these issues may increase the translational potential of HO inducers. Nevertheless, the reduction of 8-isoprostane; attenuation of inflammatory/oxidative signaling molecules, including NF-B, AP-1, AP-2, and JNK; and suppression of extracellular matrix proteins like TGF-β1, fibronectin, and collagen-1, alongside the corresponding reduction of histopathological lesions unveiled by our studies are important observations that may represents the tip of an iceberg and, thus, trigger profound investigations to address many unsettling questions.
|
Acknowledgments |
|---|
Sources of Funding
This work was supported by Canadian Health Institute of Research/University of Saskatchewan Bridge Funding and the Heart and Stroke Foundation of Saskatchewan, Canada.
Disclosures
None.
Received April 16, 2008; first decision May 2, 2008; accepted August 29, 2008.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Li X, Meng Y, Wu P, Zhang Z, Yang X. Angiotensin II and Aldosterone stimulating NF-kappaB and AP-1 activation in hepatic fibrosis of rat. Regul Pept. 2007; 138: 15–25.[CrossRef][Medline] [Order article via Infotrieve]
2. Lee SW, Han SI, Kim HH, Lee ZH. TAK1-dependent activation of AP-1 and c-Jun N-terminal kinase by receptor activator of NF-kappaB. J Biochem Mol Biol. 2002; 35: 371–376.[Medline] [Order article via Infotrieve]
3. Silvestre JS, Robert V, Heymes C, Aupetit-Faisant B, Mouas C, Moalic JM, Swynghedauw B, Delcayre C. Myocardial production of aldosterone and corticosterone in the rat. Physiological regulation. J Biol Chem. 1998; 273: 4883–4891.
4. Border WA, Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med. 1994; 331: 1286–1292.
5. Lee KY, Ito K, Hayashi R, Jazrawi EP, Barnes PJ, Adcock IM. NF-kappaB and activator protein 1 response elements and the role of histone modifications in IL-1beta-induced TGF-beta1 gene transcription. J Immunol. 2006; 176: 603–615.
6. Fenning A, Harrison G, Rose'meyer R, Hoey A, Brown L. l-Arginine attenuates cardiovascular impairment in DOCA-salt hypertensive rats. Am J Physiol Heart Circ Physiol. 2005; 289: H1408–H1416.
7. Belik J, Jankov RP, Pan J, Tanswell AK. Peroxynitrite inhibits relaxation and induces pulmonary artery muscle contraction in the newborn rat. Free Radic Biol Med. 2004; 37: 1384–1392.[CrossRef][Medline] [Order article via Infotrieve]
8. Fukunaga M, Yura T, Badr KF. Stimulatory effect of 8-Epi-PGF2 alpha, an F2-isoprostane, on endothelin-1 release. J Cardiovasc Pharmacol. 1995; 26 (suppl 3): S51–S52.[Medline] [Order article via Infotrieve]
9. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is an antioxidant of possible physiological importance. Science. 1987; 235: 1043–1046.
10. Jeney V, Balla J, Yachie A, Varga Z, Vercellotti GM, Eaton JW, Balla G. Pro-oxidant and cytotoxic effects of circulating heme. Blood. 2002; 100: 879–887.
11. Hintze KJ, Theil EC. DNA and mRNA elements with complementary responses to hemin, antioxidant inducers, and iron control ferritin-L expression. Proc Natl Acad Sci U S A. 2005; 102: 15048–15052.
12. Abraham NG, Kappas A. Pharmacological and clinical aspects of heme oxygenase. Pharmacol Rev. 2008; 60: 79–127.
13. Lavrovsky Y, Schwartzman ML, Levere RD, Kappas A, Abraham NG. Identification of binding sites for transcription factors NF-kappa B and AP-2 in the promoter region of the human heme oxygenase 1 gene. Proc Natl Acad Sci U S A. 1994; 91: 5987–5991.
14. Ndisang JF, Lane N, Jadhav A. Crosstalk between the heme oxygenase system, aldosterone, and phospholipase C in hypertension. J Hypertens. 2008; 26: 1188–1199.[CrossRef][Medline] [Order article via Infotrieve]
15. Ndisang JF, Zhao W, Wang R. Selective regulation of blood pressure by heme oxygenase-1 in hypertension. Hypertension. 2002; 40: 315–321.
16. Vreman HJ, Ekstrand BC, Stevenson DK. Selection of metalloporphyrin heme oxygenase inhibitors based on potency and photoreactivity. Pediatr Res. 1993; 33: 195–200.[Medline] [Order article via Infotrieve]
17. Rikitake Y, Oyama N, Wang CY, Noma K, Satoh M, Kim HH, Liao JK. Decreased perivascular fibrosis but not cardiac hypertrophy in ROCK1+/– haploinsufficient mice. Circulation. 2005; 112: 2959–2965.
18. Ndisang JF, Wu L, Zhao W, Wang R. Induction of heme oxygenase-1 and stimulation of cGMP production by hemin in aortic tissues from hypertensive rats. Blood. 2003; 101: 3893–3900.
19. Delanty N, Reilly MP, Pratico D, Lawson JA, McCarthy JF, Wood AE, Ohnishi ST, Fitzgerald DJ, FitzGerald GA. 8-Epi PGF2 alpha generation during coronary reperfusion. A potential quantitative marker of oxidant stress in vivo. Circulation. 1997; 95: 2492–2499.
20. Conrad CH, Brooks WW, Hayes JA, Sen S, Robinson KG, Bing OH. Myocardial fibrosis and stiffness with hypertrophy and heart failure in the spontaneously hypertensive rat. Circulation. 1995; 91: 161–170.
21. Fagan KA. Selected contribution: pulmonary hypertension in mice following intermittent hypoxia. J Appl Physiol. 2001; 90: 2502–2507.
22. Bao X, Lu CM, Liu F, Gu Y, Dalton ND, Zhu BQ, Foster E, Chen J, Karliner JS, Ross J Jr, Simpson PC, Ziegler MG. Epinephrine is required for normal cardiovascular responses to stress in the phenylethanolamine N-methyltransferase knockout mouse. Circulation. 2007; 116: 1024–1031.
23. Janssen LJ. Isoprostanes: an overview and putative roles in pulmonary pathophysiology. Am J Physiol Lung Cell Mol Physiol. 2001; 280: L1067–L1082.
24. Turkseven S, Kruger A, Mingone CJ, Kaminski P, Inaba M, Rodella LF, Ikehara S, Wolin MS, Abraham NG. Antioxidant mechanism of heme oxygenase-1 involves an increase in superoxide dismutase and catalase in experimental diabetes. Am J Physiol Heart Circ Physiol. 2005; 289: H701–H707.
25. Sun Y, Zhang J, Lu L, Chen SS, Quinn MT, Weber KT. Aldosterone-induced inflammation in the rat heart: role of oxidative stress. Am J Pathol. 2002; 161: 1773–1781.
26. Kai H, Mori T, Tokuda K, Takayama N, Tahara N, Takemiya K, Kudo H, Sugi Y, Fukui D, Yasukawa H, Kuwahara F, Imaizumi T. Pressure overload-induced transient oxidative stress mediates perivascular inflammation and cardiac fibrosis through angiotensin II. Hypertens Res. 2006; 29: 711–718.[CrossRef][Medline] [Order article via Infotrieve]
27. Okoshi MP, Yan X, Okoshi K, Nakayama M, Schuldt AJ, O'Connell TD, Simpson PC, Lorell BH. Aldosterone directly stimulates cardiac myocyte hypertrophy. J Card Fail. 2004; 10: 511–518.[CrossRef][Medline] [Order article via Infotrieve]
28. Nath KA, Haggard JJ, Croatt AJ, Grande JP, Poss KD, Alam J. The indispensability of heme oxygenase-1 in protecting against acute heme protein-induced toxicity in vivo. Am J Pathol. 2000; 156: 1527–1535.
29. Apak R, Guclu K, Ozyurek M, Karademir SE, Altun M. Total antioxidant capacity assay of human serum using copper(II)-neocuproine as chromogenic oxidant: the CUPRAC method. Free Radic Res. 2005; 39: 949–961.[CrossRef][Medline] [Order article via Infotrieve]
30. Bulger EM, Garcia I, Maier RV. Induction of heme-oxygenase 1 inhibits endothelial cell activation by endotoxin and oxidant stress. Surgery. 2003; 134: 146–152.[CrossRef][Medline] [Order article via Infotrieve]
31. Mattii L, Segnani C, Cupisti A, D'Alessandro D, Moscato S, Meola M, Barsotti G, Marino M, Bianchi F, Dolfi A, Bernardini N. Kidney expression of RhoA, TGF-beta1, and fibronectin in human IgA nephropathy. Nephron Exp Nephrol. 2005; 101: e16–e23.[CrossRef][Medline] [Order article via Infotrieve]
32. Mark A, Hock T, Kapturczak MH, Agarwal A, Hill-Kapturczak N. Induction of heme oxygenase-1 modulates the profibrotic effects of transforming growth factor-beta in human renal tubular epithelial cells. Cell Mol Biol (Noisy-le-grand). 2005; 51: 357–362.[Medline] [Order article via Infotrieve]
33. Nishikawa K. Angiotensin AT1 receptor antagonism and protection against cardiovascular end-organ damage. J Hum Hypertens. 1998; 12: 301–309.[CrossRef][Medline] [Order article via Infotrieve]
34. Sasaki T, Takahashi T, Maeshima K, Shimizu H, Toda Y, Morimatsu H, Takeuchi M, Yokoyama M, Akagi R, Morita K. Heme arginate pretreatment attenuates pulmonary NF-kappaB and AP-1 activation induced by hemorrhagic shock via heme oxygenase-1 induction. Med Chem. 2006; 2: 271–274.[CrossRef][Medline] [Order article via Infotrieve]
35. Thorup C, Jones CL, Gross SS, Moore LC, Goligorsky MS. Carbon monoxide induces vasodilation and nitric oxide release but suppresses endothelial NOS. Am J Physiol. 1999; 277: F882–F889.[Medline] [Order article via Infotrieve]
36. Johnson FK, Durante W, Peyton KJ, Johnson RA. Heme oxygenase-mediated endothelial dysfunction in DOCA-salt, but not in spontaneously hypertensive, rat arterioles. Am J Physiol Heart Circ Physiol. 2004; 286: H1681–H1687.
This article has been cited by other articles:
 |
|
 |
|
  Q. Li, Y. Guo, Q. Ou, C. Cui, W.-J. Wu, W. Tan, X. Zhu, L. B. Lanceta, S. K. Sanganalmath, B. Dawn, et al. Gene Transfer of Inducible Nitric Oxide Synthase Affords Cardioprotection by Upregulating Heme Oxygenase-1 Via a Nuclear Factor-{kappa}B-Dependent Pathway Circulation, September 29, 2009; 120(13): 1222 - 1230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jadhav and J. F. Ndisang Heme Arginate Suppresses Cardiac Lesions and Hypertrophy in Deoxycorticosterone Acetate-Salt Hypertension Experimental Biology and Medicine, July 1, 2009; 234(7): 764 - 778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Ndisang, N. Lane, and A. Jadhav Upregulation of the heme oxygenase system ameliorates postprandial and fasting hyperglycemia in type 2 diabetes Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E1029 - E1041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Ndisang and A. Jadhav Heme oxygenase system enhances insulin sensitivity and glucose metabolism in streptozotocin-induced diabetes Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E829 - E841. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jadhav, E. Torlakovic, and J. F. Ndisang Hemin therapy attenuates kidney injury in deoxycorticosterone acetate-salt hypertensive rats Am J Physiol Renal Physiol, March 1, 2009; 296(3): F521 - F534. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||