| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2008;52:1106.)
© 2008 American Heart Association, Inc.
Original Articles |
From the Diabetes Center (S.C., D.J.G., W.N., C.L.G., K.O., M.N., C.S.L., D.G.G.) and Department of Medicine (D.J.G. and D.G.G.), University of California at San Francisco.
Correspondence to David G. Gardner, 1109 HSW Diabetes Center, UCSF, 513 Parnassus Ave, San Francisco, CA 94143-0540. E-mail dgardner{at}diabetes.ucsf.edu
| Abstract |
|---|
|
|
|---|
-hydroxylase and 24-hydroxylase in the heart, 2 enzymes involved in the synthesis and metabolism of 1,25 dihydroxyvitamin D. VDR is shown to interact directly with the human B-type natriuretic peptide gene promoter, a surrogate marker of the transcriptional response to hypertrophy. Of note, induction of myocyte hypertrophy either in vitro or in vivo leads to an increase in VDR mRNA and protein levels. Collectively, these findings suggest that the key components required for a functional 1,25 dihydroxyvitamin D–dependent signaling system are present in the heart and that this putatively antihypertrophic system is amplified in the setting of cardiac hypertrophy.
Key Words: vitamin D cardiac hypertrophy nuclear receptors BNP cardiac myocyte
| Introduction |
|---|
|
|
|---|
-hydroxylation, takes place predominantly in the kidney to generate 1,25-dihydroxyvitamin D (VD3). It serves as the principal ligand for VDR in the nucleus (and extranuclear compartment) of target cells. Another enzyme, that are ubiquitously expressed 24-hydroxylase, is responsible for hydroxylating this ligand, leading to its inactivation and subsequent degradation. Recent studies suggest that VD3, in addition to stimulating absorption of intestinal calcium and promoting mineralization of bone osteoid, may play an important role in controlling cardiac hypertrophy. We have shown that VD3, as well as a number of nonhypercalcemic analogues, act in both atrial and ventricular myocytes3,4 to inhibit the activation of phenotypic markers associated with hypertrophy in vitro. Endothelin (ET)-stimulated changes in fetal gene expression and promoter activity, cell size, and protein synthesis4,5 are partially reversed by VD3 or its nonhypercalcemic analogues. Similar findings have been reported by others using the cultured cardiac HL-1 myocytes.6 In animal studies, vitamin D deficiency in Sprague-Dawley rats leads to both hypertension and cardiac hypertrophy,7 whereas treatment of Dahl salt–sensitive rats with the vitamin D analogue paricalcitol reverses cardiac hypertrophy in that model.8 The VDR knockout mouse displays hypertension, cardiac hypertrophy with enlargement of individual myocytes, and elevations in atrial natriuretic peptide (ANP) expression.9 However, the elevated blood pressure precludes assigning the liganded VDR a primary antihypertrophic role at the level of the cardiac myocyte. Although VDR has been identified microscopically10 and functionally11 in the heart, our understanding of the role of the liganded VDR in the maintenance of cardiac function remains incomplete.
Although VDR is clearly present in the heart, we know little of the specific cell types in which it is expressed nor of the functional activities associated with the liganding of these receptors. In the present article, we demonstrate the presence of VDR- and VD3-dependent functional activity in both the myocytes and fibroblasts of the rat heart. We also demonstrate the presence of the 1-
-hydroxylase enzyme in both compartments. Noteworthy, application of a hypertrophic stimulus (ET in vitro and isoproterenol in vivo) leads to an increase in VDR gene expression with little or no effect on expression of the 1-
-hydroxylase. The results indicate that a functional vitamin D–dependent signaling system is present in both cardiac myocytes and fibroblasts and support a growing body of data defining an antihypertrophic role for this system in the heart.
| Materials and Methods |
|---|
|
|
|---|
-hydoxylase antibody (PC290) was from The Binding Site (Birmingham, UK).
Isoproterenol-Induced Cardiac Hypertrophy
Wistar rats purchased from Charles River Laboratories (Wilmington, Mass) were anesthetized, and subcutaneous osmotic minipumps were implanted into the dorsum of the neck. Individual rats received vehicle alone or isoproterenol at the rate of 2.4 mg/kg per day for 7 days (n=8 each group). Animals were weighed and euthanized by CO2 narcosis followed by bilateral thoracotomy. Left ventricles were isolated and weighed. Left ventricular weight/body weight and left ventricular weight/tibial length were measured as indices of cardiac enlargement. All experiments were approved by the institutional animal care and use committee at University of California at San Francisco (UCSF).
Cell Culture
Ventricular myocytes and fibroblasts were prepared from 1- to 2-day-old neonatal Sprague-Dawley rats (Charles River Laboratories) as described previously.4 Both cell types were maintained in Dulbeccos modified Eagles medium H-21 supplemented with 10% enriched calf serum (Gemini Bioproducts; West Sacramento, Calif).
Immunoblotting
Myocytes and fibroblasts were changed from media containing 10% enriched calf serum to media containing 10% serum substitute12 for 24 hours. At that point, fresh media containing different concentrations of ET or VD3 were added. Cells were cultured for another 24 to 48 hours before being lysed in lysis buffer.13 Total protein was subjected to SDS-PAGE and transferred to membranes. The membranes were probed with an antibody directed against VDR, 24-hydroxylase, 25-hydroxyvitamin D 1-
-hydroxylase, procollagen I, or GAPDH. Blots were then incubated with horseradish peroxidase–conjugated secondary antibodies and visualized by ECL reagent (Amersham Life Sciences; Arlington Heights, Ill). When VDR-competing peptide was included in the experiment, VDR primary antibody and competing peptide were mixed at the weight ratio of 1:5. Before being added to the membrane, the mixture was diluted to a VDR antibody concentration reflecting a 1:200 final dilution. Membranes from parallel experiments were incubated with VDR antibody alone at 1:200 dilution. For tissue analysis, the left ventricle sample was homogenized. Total protein was analyzed by Western blot with anti-VDR, anti–1-
-hydoxylase, anti–24-hydoxylase, or anti-GAPDH antibodies. Signal intensities were quantified using Kodak Scientific Imaging systems.
Immunofluorescence Analysis
Cardiac myocytes or fibroblasts were isolated as described above and plated on 4-well BD Biocoat culture slides coated with fibronectin (BD Bioscience; Franklin Lakes, NJ). Cells were incubated for 48 hours and fixed using Z-Fix (Anatech Ltd; Battle Creek, Mich), followed by permeabilization with 0.1% Triton X-100. The following primary antibodies were used: rabbit anti-VDR, mouse anti–
-actinin (Sigma Aldrich; St. Louis, Mo), and mouse anti-vimentin. Anti-mouse Alexa Fluor 488 (Invitrogen; Carlsbad, Calif) and anti-rabbit Cy3 (Invitrogen) secondary antibodies were used. The slides were then mounted with Vectashield mounting medium with 4',6-diamidino-2-phenylindole (Vector Laboratories; Burlingame, Calif). Immunofluorescent images were acquired using an Olympus IX-70 inverted fluorescent microscope.
3H-Thymidine Incorporation
After serum starvation in 0.1% FBS for 12 hours, cells were treated with 10–8 mol/L VD3 for 36 hours. During the final 12 hours, they were incubated with 3H-thymidine (4 µCi/mL) in thymidine-free Eagles minimal essential medium. 3H-thymidine incorporation assay was performed as described previously.14
Transfection and Luciferase Assay
Cardiac myocytes were transiently cotransfected with a human B-type natriuretic peptide gene promoter (BNP) luciferase reporter15 and Renilla-Luc, VDR, or retinoid X receptor expression vectors16 using lipofectin reagent (Invitrogen) as reported previously.17 Twenty-four hours after transfection, cells were incubated with VD3 or 25-hydroxyvitamin D for 48 hours with or without ET for the final 24 hours. At that time point, the cells were collected and lysed. Luciferase activity was measured using the Dual-Luciferase kit (Promega; Madison, Wis). BNP luciferase activity was normalized for Renilla luciferase activity.
DNA Immunoprecipitation Assay
Cardiac myocytes were transfected with -198 human BNP (hBNP)–luciferase or pcDNA3. The media were then changed to serum free-media, and the cells were treated with 10–8 mol/L VD3 or vehicle and incubated for an additional 24 hours. At that time, the cells were treated with 10–7 mol/L ET or vehicle for 1 hour. The DNA immunoprecipitation assays were performed using a modification of published methodology.18 Briefly, after treatment, cells were fixed with 1% formaldehyde for 15 minutes at 37°C, neutralized with 0.125 mol/L glycine for 5 minutes at room temperature, washed, lysed, and sonicated. The supernatant was preincubated with protein G sepharose beads, 2 µg salmon sperm DNA, and 100 mg/mL bovine serum albumin and shaken at 4°C overnight. At that point, the supernatant was divided, either anti-VDR antibody or normal rabbit IgG was added, and the incubation was continued at 4°C overnight. Immunoprecipitates were collected then sequentially washed as described. Bound material was then eluted with freshly made elution buffer (1% sodium dodecyl sulfate and 0.1 mol/L NaHCO3). Cross-linking was reversed by heating the elutes at 65°C overnight, DNA was extracted, and polymerase chain reaction (PCR) was performed with the following primer pair: sense 5'-CCGGAATGTGGCTGATAAA-3' and antisense primer present in the luciferase gene coding sequence 5'- CTTCCAGCGGATAGAATGGC-3'.
Total RNA Isolation and Real-Time PCR
Total RNA was isolated from cardiac myocytes and fibroblasts and left ventricles with the RNeasy kit (Qiagen) and reverse transcribed into cDNA. Real-time PCR was performed with rat ANP (Rn00561661_ml) and GAPDH (Rn99999916_sl) Taqman primers (Applied Biosystems; Foster City, Calif) and rat VDR (sense: AGGACAACCGGCGACACT; antisense: CTGTACCTCCTCATCTGTCA), rat 1-
-hydroxylase (sense: CTGCAGAGACTGGGATCAGA; antisense: AAATCCTCCTCAGGCTTTCC), and GAPDH (sense: GACATGCCGCCTGGAGAAAC; antisense: AGCCCAGGATGCCCTTTAGT) SYBR Green primers. ANP, VDR, and 1-
-hydroxylase mRNA levels were normalized to GAPDH mRNA expression. Real-time PCR was performed on the ABI Prism 7900HT (Applied Biosystems).
Statistical Analysis
Data were analyzed by 1-way ANOVA using Student-Newman–Keuls post hoc test.
| Results |
|---|
|
|
|---|
55 kDa) was identified in extracts of both cell populations as well as inner medullary collecting duct cells, a population that has been shown to respond to vitamin D in previous studies.17 This immunoreactivity was competed effectively by antigenic VDR peptide (Figure 1C). Interestingly, treatment of either the myocyte (Figure 1A) or fibroblast (Figure 1B) cultures with the prohypertrophic vasoactive peptide ET resulted in a significant increase in levels of the VDR protein. A similar stimulation of VDR mRNA transcripts by ET was seen in both myocytes and fibroblasts (Figure 1D). ET-stimulated VDR mRNA expression was seen as early as 4 hours, peaked at 14 hours, and gradually declined at 24 hours in both types of cells (data not shown).
|
In an effort to confirm the presence of VDR through independent methodology, we performed immunocytochemistry of both myocytes and fibroblasts (Figure 2) in culture. Myocytes were stained with antibody directed against
-actinin to demonstrate sarcomeric structure, as well the anti-VDR antibody, whereas fibroblasts were stained with antivimentin, an antibody that selectively stains these cells.19 In both cases, the anti-VDR antibody identified immunoreactivity in the nuclei and, to a lesser degree, the cytoplasm, of the cells. The pattern of staining in the myocytes was coarser and aggregated in selected subnuclear locations, whereas that in the fibroblasts was intense but homogenous throughout the nucleus.
|
To assess the effects of the liganded VDR on the nonmyocyte population in the heart, we treated cells with VD3 for 36 to 48 hours before assessing proliferative (ie, 3H-thymidine incorporation) as well as synthetic effects (ie, procollagen I levels) in these cultures. As shown in Figure 3, VD3 treatment resulted in a significant reduction in both 3H-thymidine incorporation (Figure 3A) as well as procollagen I levels (Figure 3B), demonstrating that VD3 has important biological effects in these cells and suggesting that it may have antifibrotic activity in the interstitial compartment of the myocardium.
|
To confirm the biological activity of VD3 in the myocyte cultures, we transfected an hBNP luciferase reporter into these cells. BNP gene expression and BNP promoter activity serve as surrogate markers of hypertrophy.13,20,21 We then treated them with VD3 or 1 of 2 nonhypercalcemic analogues of VD3 (ie, paricalcitol or active hectorol), followed by the prohypertrophic peptide ET. As shown in Figure 4A, treatment of cells with 10–7 mol/L ET resulted in a >2-fold increase in promoter activity in these experiments. As shown in the same panel, pretreatment with VD3 or the nonhypercalcemic analogues of VD3 resulted in a reduction in basal hBNP promoter activity and a significant reduction in the ET-dependent stimulation of promoter activity. In each case, the effective dose range was similar among the 3 VDR ligands. We also tested the ability of the VD3 precursor 25-hydroxyvitamin D to suppress basal hBNP promoter activity. As shown in Figure 4B, 25-hydroxyvitamin D also led to a reduction in hBNP promoter activity, although, perhaps, with somewhat lower potency (compare effect of 10–10 mol/L VD3 in Figure 4A with effect of 10–10 mol/L 25-hydroxyvitamin D in Figure 4B). The ability of the precursor to mirror activity of VD3 implies that these cultures may have the requisite enzymatic machinery to convert 25-hydroxyvitamin D to VD3 (ie, 1-
-hydroxylase). As shown in Figure 4C, this was confirmed by Western blot analysis and real-time PCR, which demonstrated immunoreactive 1-
-hydroxylase protein and mRNA in the myocyte cultures. In this case, protein and mRNA levels were unaffected by ET treatment. Expression of 1-
-hydroxylase mRNA was also seen in cultured fibroblasts and was not changed following ET treatment (VD3 1.14±0.17-fold induction versus control; mean±SD; n=3).
|
To determine whether VDR was directly associated with the hBNP promoter, we performed DNA immunoprecipitation analysis of myocyte cultures, previously transfected with the -198 hBNP-luciferase reporter, and then treated them with VD3 in the presence or absence of ET. As shown in Figure 5A, this construct responded to VD3 treatment in a qualitatively similar fashion to the longer promoter construct used above. Promoter activity was reduced by
30% by VD3 treatment alone and by >80% when the cells were cotransfected with VDR and retinoid X receptor (heterodimeric partner of VDR) before VD3 treatment. Figure 5B exhibits a direct association of VDR with the hBNP promoter. This association was undetectable at baseline but increased after treatment with the VDR ligand. Treatment with ET resulted in an increase in VDR association with the promoter, and this was further amplified by addition of the VDR ligand.
|
The ET-dependent induction of VDR was an unexpected finding and raised the possibility that the activation of hypertrophy by ET might be the driving force behind the increased expression of the putatively antihypertrophic VDR (ie, a closed-loop feedback system). To test this further, we investigated cardiac VDR expression in a rat model of myocardial hypertrophy after 7 days of continuous isoproterenol infusion. This infusion reliably generates significant increases in cardiac mass and hypertrophy-dependent gene expression (eg, ANP) over this time interval.22 As shown in Figure 6A, isoproterenol-treated rats experienced a significant increase in left ventricular size when normalized either to body weight or tibial length. This was accompanied by a significant increase in ANP gene expression, demonstrated in Figure 6B, reflecting activation of the fetal gene expression in the hypertrophied myocardium.23 We also observed a significant increment in VDR mRNA and protein levels in the isoproterenol-treated animals (Figure 6C) but no increase in the expression of 1-
-hydroxylase, 24-hydroxylase or GAPDH protein (Figure 6D), or the 1-
-hydroxylase mRNA (1.04±0.25-fold induction relative to control; mean±SD; n=4).
|
| Discussion |
|---|
|
|
|---|
-hydroxylase in the same sources and 24-hydroxylase protein in the intact heart, (3) the demonstration that VDR has the capacity to bind directly to the BNP gene promoter, and (4) the finding that activation of myocyte hypertrophy, either in vitro or in vivo, is associated with a significant increase in VDR expression. Previous studies have suggested a role of the VD3/VDR system in the control of cardiac function. Our group has shown previously that VD3 as well as less hypercalcemic analogues of VD3 demonstrate antihypertrophic activity in cultured neonatal rat cardiac myocytes.5,14,16 The VDR gene knockout mouse displays significant cardiac hypertrophy and activation of hypertrophy-dependent gene expression, which can be linked directly to increased myocyte size.9 Moreover, Bodyak et al recently demonstrated that the VD3 analogue paricalcitol reduces cardiac hypertrophy, without affecting blood pressure, in the Dahl salt–sensitive rat.8 A variety of clinical studies lend additional support. Vitamin D deficiency in early childhood is associated with significant cardiomyopathy and congestive heart failure.24 Several independent studies in adult patients have linked congestive heart failure to reduced levels of circulating 25-hydroxyvitamin D levels.25 Finally, Park et al reported that low circulating levels of VD3 in patients with chronic renal failure on dialysis are linked to the presence of ventricular hypertrophy.26 Remarkably, treatment of these patients with exogenous VD3 resulted in amelioration of the hypertrophy.
Immunoreactive VDR has been described in human heart and cultured cardiac HL-1 cells.6 To our knowledge, ours is the first report that demonstrates VDR expression in both the myocyte and cardiac fibroblast and the first to document hypertrophy-dependent stimulation of VDR expression. The presence of VDR in both myocytes and fibroblasts implies that the potential exists for widespread effects of the liganded receptor in the heart (eg, suppression of myocyte hypertrophy and interstitial fibrosis). It also engenders a need to be cautious in interpreting effects of vitamin D on the heart in the whole animal. Such effects could result from direct interactions with the cardiac myocyte, indirect hemodynamic effects (eg, reductions in blood pressure), or indirect paracrine effects resulting from ligand-dependent interactions with neighboring fibroblasts.
The presence of 1-
-hydroxylase in myocytes and fibroblasts implies that the heart has the capacity to synthesize the bioactive VD3 metabolite independent of its production in the kidney, using circulating plasma 25-hydroxyvitamin D as substrate.27 Similar 1-
-hydroxylase immunoreactivity has been demonstrated in inflammatory cells,28 breast,29 colon,30 and prostate cancer cells.31 This is an important consideration because it places cardiac production of VD3 outside those regulatory controls that govern renal production of the ligand. In the intact heart, local tissue VD3 levels would then be a function of endogenous synthesis (ie, cardiac 1-
-hydroxylase activity and circulating plasma 25-hydroxyvitamin D levels), delivery of circulating plasma VD3 to the heart, and degradation of VD3 (eg, through 24-hydroxylase activity).
The fact that VDR binds directly to the hBNP gene promoter indicates that at least some of the effects of VD3 operate directly at the level of target gene expression in suppressing the hypertrophic phenotype rather than indirectly (eg, through alterations in hemodynamics or inhibition of inflammatory markers associated with hypertrophy). After treatment with ET, VDR binds to the hBNP promoter in the absence of exogenous ligand, a finding compatible with either ligand-independent activity of this receptor32 or alternatively, low-level production of VD3 in these cultures. In any case, addition of exogenous ligand clearly amplified association of VDR with the promoter. Interestingly, treatment with ET resulted in increased VDR binding, likely reflecting the hypertrophy-dependent increment in VDR available for binding in these cultures.
Finally, the induction of VDR expression with hypertrophic stimuli in vitro or in vivo might be predicted to have important implications in terms of the regulation of the hypertrophic process. In both the neonatal rat myocyte, a traditional model for studying myocyte hypertrophy in vitro,23 and the in vivo model of isoproterenol-induced hypertrophy,22 we observed an induction of VDR gene expression. The induction appears to be somewhat selective for VDR in the nuclear receptor gene family. Other family members, most notably the peroxisome proliferators activator receptor
and thyroid hormone receptor, are downregulated in the cardiac myocyte with the development of hypertrophy.33,34 We and others have suggested that VD3 or its less hypercalcemic analogues suppress myocyte hypertrophy in vivo8 and in vitro.4 Amplification of VDR expression in hypertrophy suggests that the myocyte is attempting to close a negative-feedback loop that would serve to dampen the magnitude of hypertrophic growth. Interference with the activation of this feedback mechanism would be predicted to amplify the hypertrophic response and conceivably favor progression to cardiac decompensation and heart failure.
Perspectives
Recent studies suggest that vitamin D may play an important physiological role in controlling cardiac hypertrophy. The present study adds support for this hypothesis in demonstrating that the key components of the vitamin D–dependent signaling system (ie, VDR, 1-
-hydroxylase, and 24-hydroxylase) are present in cardiac myocytes and fibroblasts. It also demonstrates for the first time that levels of VDR are upregulated during hypertrophy, implying activation of a counter-regulatory mechanism to control growth in the hypertrophied heart. Collectively, these data suggest that the use of vitamin D, vitamin D analogues, or drugs that modulate vitamin D metabolism could be beneficial in the management of disorders associated with cardiac hypertrophy.
| Acknowledgments |
|---|
Sources of Funding
This work was supported by National Institutes of Health grants HL45637 (D.G.G.) and F32 HL086158 (D.J.G.), American Heart Association grant 0825140F (W.N.), and a grant from Abbott Laboratories.
Disclosures
None.
| Footnotes |
|---|
Received July 15, 2008; first decision August 10, 2008; accepted September 25, 2008.
| References |
|---|
|
|
|---|
2. Holick MF. Vitamin D deficiency. N Engl J Med. 2007; 357: 266–281.
3. Li Q, Gardner DG. Negative regulation of the human atrial natriuretic peptide gene by 1,25-dihydroxyvitamin D3. J Biol Chem. 1994; 269: 4934–4939.
4. Wu J, Garami M, Cheng T, Gardner DG. 1,25(OH)2 vitamin D3, and retinoic acid antagonize endothelin-stimulated hypertrophy of neonatal rat cardiac myocytes. J Clin Invest. 1996; 97: 1577–1588.[Medline] [Order article via Infotrieve]
5. Wu J, Garami M, Cao L, Li Q, Gardner DG. 1,25(OH)2D3 suppresses expression and secretion of atrial natriuretic peptide from cardiac myocytes. Am J Physiol. 1995; 268: E1108–E1113.[Medline] [Order article via Infotrieve]
6. Nibbelink KA, Tishkoff DX, Hershey SD, Rahman A, Simpson RU. 1,25(OH)2-vitamin D3 actions on cell proliferation, size, gene expression, and receptor localization, in the HL-1 cardiac myocyte. J Steroid Biochem Mol Biol. 2007; 103: 533–537.[CrossRef][Medline] [Order article via Infotrieve]
7. Weishaar RE, Simpson RU. Vitamin D3 and cardiovascular function in rats. J Clin Invest. 1987; 79: 1706–1712.[Medline] [Order article via Infotrieve]
8. Bodyak N, Ayus JC, Achinger S, Shivalingappa V, Ke Q, Chen YS, Rigor DL, Stillman I, Tamez H, Kroeger PE, Wu-Wong RR, Karumanchi SA, Thadhani R, Kang PM. Activated vitamin D attenuates left ventricular abnormalities induced by dietary sodium in Dahl salt-sensitive animals. Proc Natl Acad Sci U S A. 2007; 104: 16810–16815.
9. Xiang W, Kong J, Chen S, Cao LP, Qiao G, Zheng W, Liu W, Li X, Gardner DG, Li YC. Cardiac hypertrophy in vitamin D receptor knockout mice: role of the systemic and cardiac renin-angiotensin systems. Am J Physiol Endocrinol Metab. 2005; 288: E125–E132.
10. Tishkoff DX, Nibbelink KA, Holmberg KH, Dandu L, Simpson RU. Functional vitamin D receptor (VDR) in the t-tubules of cardiac myocytes: VDR knockout cardiomyocyte contractility. Endocrinology. 2008; 149: 558–564.
11. Walters MR, Wicker DC, Riggle PC. 1,25-Dihydroxyvitamin D3 receptors identified in the rat heart. J Mol Cell Cardiol. 1986; 18: 67–72.[Medline] [Order article via Infotrieve]
12. Bauer RF, Arthur LO, Fine DL. Propagation of mouse mammary tumor cell lines and production of mouse mammary tumor virus in a serum-free medium. In Vitro. 1976; 12: 558–563.[Medline] [Order article via Infotrieve]
13. Levin ER, Gardner DG, Samson WK. Natriuretic peptides. N Engl J Med. 1998; 339: 321–328.
14. Chen S, Gardner DG. Retinoic acid uses divergent mechanisms to activate or suppress mitogenesis in rat aortic smooth muscle cells. J Clin Invest. 1998; 102: 653–662.[Medline] [Order article via Infotrieve]
15. LaPointe MC, Wu G, Garami M, Yang XP, Gardner DG. Tissue-specific expression of the human brain natriuretic peptide gene in cardiac myocytes. Hypertension. 1996; 27: 715–722.
16. Chen S, Costa CH, Nakamura K, Ribeiro RC, Gardner DG. Vitamin D-dependent suppression of human atrial natriuretic peptide gene promoter activity requires heterodimer assembly. J Biol Chem. 1999; 274: 11260–11266.
17. Chen S, Olsen K, Grigsby C, Gardner DG. Vitamin D activates type A natriuretic peptide receptor gene transcription in inner medullary collecting duct cells. Kidney Int. 2007; 72: 300–306.[Medline] [Order article via Infotrieve]
18. Nissen RM, Yamamoto KR. The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 2000; 14: 2314–2329.
19. Grimm D, Huber M, Jabusch HC, Shakibaei M, Fredersdorf S, Paul M, Riegger GA, Kromer EP. Extracellular matrix proteins in cardiac fibroblasts derived from rat hearts with chronic pressure overload: effects of beta-receptor blockade. J Mol Cell Cardiol. 2001; 33: 487–501.[CrossRef][Medline] [Order article via Infotrieve]
20. Gardner RS, Chong KS, Morton JJ, McDonagh TA. A change in N-terminal pro-brain natriuretic peptide is predictive of outcome in patients with advanced heart failure. Eur J Heart Fail. 2007; 9: 266–271.[CrossRef][Medline] [Order article via Infotrieve]
21. Gardner DG. Natriuretic peptides: markers or modulators of cardiac hypertrophy? Trends Endocrinol Metab. 2003; 14: 411–416.[CrossRef][Medline] [Order article via Infotrieve]
22. Boluyt MO, Bing OH, Lakatta EG. The ageing spontaneously hypertensive rat as a model of the transition from stable compensated hypertrophy to heart failure. Eur Heart J. 1995; 16 (suppl N): 19–30.
23. Chien KR, Knowlton KU, Zhu H, Chien S. Regulation of cardiac gene expression during myocardial growth and hypertrophy: molecular studies of an adaptive physiologic response. Faseb J. 1991; 5: 3037–3046.[Abstract]
24. Uysal S, Kalayci AG, Baysal K. Cardiac functions in children with vitamin D deficiency rickets. Pediatr Cardiol. 1999; 20: 283–286.[CrossRef][Medline] [Order article via Infotrieve]
25. Zittermann A, Schleithoff SS, Koerfer R. Vitamin D insufficiency in congestive heart failure: why and what to do about it? Heart Fail Rev. 2006; 11: 25–33.[CrossRef][Medline] [Order article via Infotrieve]
26. Park CW, Oh YS, Shin YS, Kim CM, Kim YS, Kim SY, Choi EJ, Chang YS, Bang BK. Intravenous calcitriol regresses myocardial hypertrophy in hemodialysis patients with secondary hyperparathyroidism. Am J Kidney Dis. 1999; 33: 73–81.[Medline] [Order article via Infotrieve]
27. Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM, Hewison M. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-hydroxylase. J Clin Endocrinol Metab. 2001; 86: 888–894.
28. Fritsche J, Mondal K, Ehrnsperger A, Andreesen R, Kreutz M. Regulation of 25-hydroxyvitamin D3-1 alpha-hydroxylase and production of 1 alpha,25-dihydroxyvitamin D3 by human dendritic cells. Blood. 2003; 102: 3314–3316.
29. Friedrich M, Rafi L, Mitschele T, Tilgen W, Schmidt W, Reichrath J. Analysis of the vitamin D system in cervical carcinomas, breast cancer and ovarian cancer. Recent Results Cancer Res. 2003; 164: 239–246.[Medline] [Order article via Infotrieve]
30. Cross HS, Bareis P, Hofer H, Bischof MG, Bajna E, Kriwanek S, Bonner E, Peterlik M. 25-Hydroxyvitamin D(3)-1alpha-hydroxylase and vitamin D receptor gene expression in human colonic mucosa is elevated during early cancerogenesis. Steroids. 2001; 66: 287–292.[CrossRef][Medline] [Order article via Infotrieve]
31. Chen TC, Wang L, Whitlatch LW, Flanagan JN, Holick MF. Prostatic 25-hydroxyvitamin D-1alpha-hydroxylase and its implication in prostate cancer. J Cell Biochem. 2003; 88: 315–322.[CrossRef][Medline] [Order article via Infotrieve]
32. Ross TK, Darwish HM, Moss VE, DeLuca HF. Vitamin D-influenced gene expression via a ligand-independent, receptor-DNA complex intermediate. Proc Natl Acad Sci U S A. 1993; 90: 9257–9260.
33. Kinugawa K, Yonekura K, Ribeiro RC, Eto Y, Aoyagi T, Baxter JD, Camacho SA, Bristow MR, Long CS, Simpson PC. Regulation of thyroid hormone receptor isoforms in physiological and pathological cardiac hypertrophy. Circ Res. 2001; 89: 591–598.
34. Karbowska J, Kochan Z, Smolenski RT. Peroxisome proliferator-activated receptor alpha is downregulated in the failing human heart. Cell Mol Biol Lett. 2003; 8: 49–53.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
S. Pilz and A. Tomaschitz Vitamin D deficiency and myocardial dysfunction. J. Am. Coll. Cardiol., May 26, 2009; 53(21): 2011 - 2011. [Full Text] [PDF] |
||||
![]() |
E. Giovannucci Expanding Roles of Vitamin D J. Clin. Endocrinol. Metab., February 1, 2009; 94(2): 418 - 420. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Hypertension Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |