Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 2008;52:1142-1148
Published online before print October 20, 2008, doi: 10.1161/HYPERTENSIONAHA.108.114082
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
52/6/1142    most recent
HYPERTENSIONAHA.108.114082v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugimoto, K.
Right arrow Articles by Rakugi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugimoto, K.
Right arrow Articles by Rakugi, H.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Clinical genetics
Right arrow Other hypertension

(Hypertension. 2008;52:1142.)
© 2008 American Heart Association, Inc.


Original Articles

A Polymorphism Regulates CYP4A11 Transcriptional Activity and Is Associated With Hypertension in a Japanese Population

Ken Sugimoto; Hiroshi Akasaka; Tomohiro Katsuya; Koichi Node; Tomomi Fujisawa; Izumi Shimaoka; Osamu Yasuda; Mitsuru Ohishi; Toshio Ogihara; Kazuaki Shimamoto; Hiromi Rakugi

From the Department of Geriatric Medicine (K.S., T.K., T.F., I.S., O.Y., M.O., H.R.), Osaka University Graduate School of Medicine, Osaka, Japan; Second Department of Internal Medicine (H.A., K.S.), Sapporo Medical University, Sapporo, Japan; Cardiovascular and Renal Medicine (K.N.), Saga University Faculty of Medicine, Saga, Japan; and Osaka General Medical Center (T.O.), Osaka Prefectural Hospital Organization, Osaka, Japan.

Correspondence to Tomohiro Katsuya, Department of Geriatric Medicine, Osaka University Graduate School of Medicine, 2-2 #B6, Yamadaoka, Suita, Osaka 565-0871, Japan. E-mail katsuya{at}geriat.med.osaka-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
CYP4A11 oxidizes arachidonic acid to 20-hydroxyeicosatetraenoic acid, a metabolite with renovascular and tubular function in humans. A previous study demonstrated a significant association between the CYP4A11 gene polymorphism and hypertension; however, the precise mechanism of the association has not been clarified. To assess the involvement of CYP4A11 in the pathogenesis of hypertension, we sought to identify a functional polymorphism of CYP4A11 and examined its impact on predisposition to hypertension in the Tanno-Sobetsu Study. The –845A/G polymorphism was identified in the promoter region of CYP4A11 by direct sequencing. Luciferase expression driven by the promoter of CYP4A11 containing the wild-type –845GG genotype was 30% lower than expression with the variant –845AA genotype. Gel mobility shift assays with nuclear protein extracts showed specific binding to probes containing the variant –845GG. To assess the effect of CYP4A11 polymorphisms on hypertension, we also carried out a case-control study using 4 single nucleotide polymorphisms (–845A/G, –366C/T, 7119C/T, and 8590T/C) in the Tanno-Sobetsu Study. The odds ratio for hypertension in participants with the AG+GG genotype of –845A/G was 1.42 (P=0.008), and the odds ratio for hypertension of the TT genotype of 7119C/T was 1.37 (P=0.037) after adjusting for confounding factors. The haplotype-based case-control analysis using 4 single nucleotide polymorphisms revealed a significant haplotype (G-C-T-T) that was significantly associated with hypertension, with an odds ratio of 1.44 (P=0.006) after adjusting for confounding factors. We have identified a functional variant (–845A/G) of CYP4A11 that is significantly associated with hypertension and that appears to be a novel candidate for a predisposing factor for hypertension.


Key Words: genetics • hypertension • single nucleotide polymorphism (SNP) • CYP4A11 gene • renal circulation • transcription factor


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The metabolism of arachidonic acid by cytochrome P450 (CYP) enzymes leads to the formation of various biologically active eicosanoids, such as hydroxyeicosatetraenoic acids, epoxyeicosatrienoic acids, and dihydroxyeicosatrienoic acids.1–3 20-Hydroxyeicosatetraenoic acid (20-HETE) is a strong vasoconstrictor and acts as a second messenger for vasoactive peptides (angiotensin II and endothelin). Recent reports have revealed that 20-HETE plays a dual role in the regulation of blood pressure (BP) by inducing renal vasoconstriction (prohypertensive function), as well as inhibiting sodium reabsorption in tubules (antihypertensive function).4

20-HETE is normally produced in renal and cerebral arterioles,5,6 the glomerulus, and the renal tubules7,8 and has been implicated in the regulation of contractile state, ion flux, and mitogenesis. 20-HETE is generated from arachidonic acid by CYP4A, also known as omega/omega-1 hydroxylase.9,10 It has been reported that administration of antisense oligonucleotides to CYP4A1 reduces BP in spontaneously hypertensive rats,11 and the expression of CYP4A is involved in early changes in eicosanoid formation and renal function in the young spontaneously hypertensive rats.12 The Cyp4a14 gene-disrupted mice showed increases in plasma androgens, kidney Cyp4a12 expression, and the formation of prohypertensive 20-HETE, which resulted in hypertension.13 A recent report demonstrated that CYP4A11, originally isolated from human kidney and liver cDNA libraries,14,15 is the human homologue of mouse CYP4a14, expressed in human renal tubule and not in afferent arterioles. The report also described CYP4A11 regulation of 20-HETE.16 Despite the potential involvement of CYP4A11 in regulating BP through 20-HETE, the exact function of the CYP4A11 gene is still unknown.

Genetic approaches may provide a powerful tool for clarifying the pathogenesis of essential hypertension;17 however, a recent report of a genome-wide association study18 failed to establish a consensus in identifying a "hypertensive gene." In contrast, several recent reports have suggested a critical role for the CYP4A11 polymorphism in predisposition to hypertension.19–21

Our investigation of a candidate gene for hypertension included 3 major objectives. We sought to detect a functional polymorphism of the CYP4A11 gene in Japanese people and to determine the molecular outcomes associated with the detected polymorphism in relation to hypertension. To achieve our third objective of clarifying the genetic involvement of CYP4A11 in the pathogenesis of hypertension, we carried out a case-control study within the Tanno-Sobetsu Study.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Polymorphism Identification and Genotyping
We generated primers specific for the promoter and exon regions of the CYP4A11 gene and used the primers for PCR amplifications. Four amplicons in the promoter region and 12 in the exon region were purified using ExoSAP-IT (GE Healthcare UK Ltd) and subjected to sequence analysis. Sequencing was performed using the 1.1 Big-Dye deoxy terminator cycle sequencing kit (Applied Biosystems, Inc), and analysis of sequencing reactions was carried out on the ABI Prism 3100 Genetic Analyzer (Applied Biosystems). The sequences were aligned with wild-type sequences obtained from the National Center for Biotechnology Information Web site (CYP4A11; AY369778) and examined for the presence of mutations.

Luciferase Assay
DNA fragments of the 5'-flanking region of the CYP4A11 gene (nucleotide positions –891 to –260), with and without the –845GG genotype, were amplified from genomic DNA by PCR. The primers used for PCR amplification contained BglII and SpeI sites (upstream; 5'-GAAGATCT (BglII) GGTCAGGACTCCTAAACAGAG, downstream; 5'-GACTAGT (SpeI) GGCAACAGTGGGAGAAA), and the PCR products were digested and fused into the luciferase reporter vector phRL-null (Promega). Normal human renal proximal tubule epithelial cells (RPTECs) were used for the luciferase assays. Transient transfections were performed with NRK-52E (Amaxa), according to the manufacturer’s instructions. The promoter/luciferase reporter plasmid (5 mg) and an internal luciferase control were transfected into RPTECs, and cells were incubated for 48 hours. Cell extracts were assessed for luciferase activity using the Dual-Glo Luciferase Assay System (Promega), according to the manufacturer’s protocol. The measurements were performed in a luminometer (ARVO MX, PerkinElmer) in triplicate. Firefly luciferase activity, as a measure of CYP4A11 promoter activity, was normalized against the Renilla luciferase internal control and expressed in relative activity units. The pGL3-control vector (Promega) was used as a negative control.

Electrophoretic Mobility Shift Assay
Nuclear extracts from RPTECs were prepared using the Nuclear/Cytosol Fractionation kit (BioVision, Inc) according to the manufacturer’s instructions and diluted to a final protein concentration of 1 mg/mL. The double-stranded oligonucleotides used for binding were as follows: 4A11-wt (–855 to –825), 5'-GTGTAATTACATACTATTGTAGGGTGAAAGA, and 4A11-mt (–855 to –825), 5'-GTGTAATTACGTACTATTGTAGGGTGAAAGA. A total of 10 mg of nuclear extract was incubated with 1 mg of poly [d(I-C)] plus the digoxigenin-labeled oligonucleotide (0.8 ng; Dig Gel Shift kit, 2nd Generation, Roche, Inc) in the presence or absence of unlabeled oligonucleotides for 15 minutes at 15°C to 25°C. The binding reaction was carried out in a solution containing 20 mmol/L of HEPES (pH 7.6), 1 mmol/L of EDTA, 10 mmol/L of (NH4)2SO4, 1 mmol/L of dithiothreitol, 0.2% Tween 20, and 30 mmol/L of KCl. The reaction mixtures (final volume: 20 mL) were directly loaded onto an 8% 90 mmol/L Tris/64.6 mmol/L boric acid/2.5 mmol/L EDTA (pH 8.3) polyacrylamide gel (Invitrogen, Inc), which had been run for 5 minutes before sample loading. After electrophoresis (80 V for 60 minutes at 4°C), the gels were transferred to nylon membranes in 90 mmol/L Tris/64.6 mmol/L boric acid/2.5 mmol/L EDTA (pH 8.3) buffer (300 mA for 60 minutes at 4°C) using the NuPAGE system (Invitrogen, Inc) and cross-linked at 120 mJ/cm2 for 3 minutes, followed by chemiluminescent detection using the CSPD working solution (Roche, Inc).

Population Study: The Tanno-Sobetsu Study
A total of 1501 participants were recruited from the Tanno-Sobetsu Study designed by the Second Department of Internal Medicine, Sapporo Medical University. The study started in 1977 with a cohort base in the northern part of Japan, Hokkaido, and the detailed epidemiological findings have been reported previously.22 BP was measured twice in each participant while seated, after 5 minutes of rest. Hypertension was defined as systolic BP ≥140 mm Hg, diastolic BP ≥90 mm Hg, or the current use of antihypertensive agents. Normotensive (n=748; mean age: 57.9 years; 38.4% men) and hypertensive (n=753; mean age: 67.3; 39.7% men) participants were divided based on this definition. To match the 2 groups by age and sex, the participants were reduced by a random score method. The random scores were assigned to the remaining cases by multiplying age and sex by a uniform 0-to-1 random variable. A random selection with an age or sex bias was achieved by removing cases, starting with the lowest scores. This process was performed incrementally until the mean age for the 2 groups had been sufficiently matched. By the matching method, the mean age and the ratio of men in the normotensive (n=494) and hypertensive (n=495) groups were, respectively, 65.7 years and 46.96% men in the normotensive group and 65.6 years and 46.06% men in the hypertensive group (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Patient Baseline Characteristics

All of the participants gave written informed consent to the genetic analysis and all of the other procedures associated with the study. The ethics committee of Osaka University approved the study protocol.

Genotyping
The single nucleotide polymorphism (SNP) assays for –845A/G, –366C/T, 7119C/T, and 8590T/C (described in detail in the Results section) were performed using the TaqMan PCR method. The primers and probes are shown in Table 2. Probes were labeled with the fluorescence FAM (mutant type) or VIC (wild-type). Genotyping was performed twice with 5 ng of DNA per reaction in a total reaction volume of 10 mL on 386-well plates. The thermocycler parameters were as follows: 50°C for 2 minutes, 95°C for 10 minutes, 45 cycles of 95°C for 15 seconds, and 60°C for 60 seconds. Allelic discrimination was measured automatically on the ABI Prism HT7900 (Applied Biosystems) using the Sequence Detection System 3.1 software.


View this table:
[in this window]
[in a new window]

 
Table 2. The Primer and Probe Sequences for Genotyping of the CYP4A11 Gene

Statistical Analysis
A power analysis for this case-control study (a 1-to-1 relationship between hypertensive and normotensive subjects) showed that a sample size of 495 individuals in each group would be required to replicate these results with a power of 80% and an {alpha} of 0.05 when the estimated odds ratio (OR) for the case is set at 1.42; this analysis was made using the online calculator available at the Genetic Power Calculator Web site (http://pngu.mgh.harvard. edu/~purcell/gpc).

All of the continuous variables were expressed as means±SD. Differences in continuous variables between hypertensive and normotensive participants were analyzed using 1-way ANOVA. Differences in categorical variables were analyzed using the Fisher’s exact test. The Hardy-Weinberg equilibrium was assessed by {chi}2 analysis. The difference in CYP4A11 genotype or allele distribution between hypertensive and normotensive participants was analyzed using {chi}2 analysis. Based on the genotype data of the genetic variations, we performed linkage disequilibrium analysis and haplotype-based case-control analysis using the expectation maximization algorithm23 and the software Haploview 4.1 (Daly Laboratory, Broad Institute). Pairwise linkage disequilibrium analysis was performed for –845A/G, – 366C/T, 7119C/T, and 8590T/C. We used |D'| values of >0.5 to assign SNP locations to 1 haplotype block. SNPs with an r2 value of <0.5 were selected as tagged, which means they were available for the haplotype. In the haplotype-based case-control analysis, haplotypes with a frequency of <0.01 were excluded. The frequency distribution of the haplotypes was calculated by {chi}2 analysis.

In addition, logistic regression analysis was performed to assess the contribution of the major risk factors. ORs were calculated as an index of the association of the CYP4A11 genotypes with the prevalence of hypertension. Gene expression and luciferase activity were compared by 2-tailed unpaired t tests. Statistical significance was established at P<0.05. Statistical analyses were performed using JMP software for Macintosh 5.1.1 (SAS Institute, Inc).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Polymorphism Identification
We performed sequence analysis of the CYP4A11 gene and promoter region in 32 healthy human samples. Distribution of the SNPs detected in the promoter and exon regions of the CYP4A11 gene are shown in Figure 1. Four polymorphisms in the promoter and exon regions of CYP4A11 were detected, –845A/G, –366C/T, 7119C/T, and 8590T/C, with an allelic frequency of >1%. We chose the promoter polymorphism (–845A/G) for the following experiments and functional analysis, because the frequency of the variant allele of –845A/G was much higher than that of –366C/T (27.6% and 7.0%, respectively); thus, this polymorphism was thought to have the potential to alter the transcription efficiency of the CYP4A11 gene.


Figure 1
View larger version (5K):
[in this window]
[in a new window]

 
Figure 1. SNPs in the CYP4A11 gene.

Functional Analysis of the –845A/G Polymorphism
To determine the functional consequence of the –845A/G polymorphism in the promoter region, we constructed luciferase reporter vectors driven by the wild-type –845AA promoter (phRL-4A11wt) and mutant –845GG promoter (phRL-4A11mt) and performed luciferase assays. The results demonstrated that promoter activity of the variant –845GG promoter was significantly lower than that of the wild-type –845AA promoter (Figure 2).


Figure 2
View larger version (9K):
[in this window]
[in a new window]

 
Figure 2. Comparison of the transcriptional activity of CYP4A11 promoter genotypes.

Next we used a gel mobility shift assay to assess DNA binding activity on the promoter region containing the polymorphism. Human RPTEC nuclear extracts were incubated with the digoxigenin-labeled wild-type AA genotype or variant GG genotype probes, in the absence or presence of excess of unlabeled probe (Figure 3). Notably, we observed DNA binding activity (shifted band, {approx}35 kDa) with the oligonucleotide containing the variant –845GG genotype but not with the wild-type AA genotype.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

 
Figure 3. Results of the gel mobility shift assay for the CYP4A11 promoter.

Population Study
Table 2 shows the baseline characteristics of the age- and sex-matched normotensive and hypertensive groups. Those with hypertension had higher values for systolic BP, diastolic BP, triglyceride, and blood sugar levels. We performed genotyping of the 4 SNPs (–845A/G, –=366C/T, 7119C/T, and 8590T/C) in the Tanno-Sobetsu Study population, and the resulting genotype frequencies were not significantly different from the predicted Hardy-Weinberg expectation (data not shown).

To determine whether an association exists between the variants and hypertension, we performed Fisher’s exact tests for all 4 of the SNPs. Table 3 shows the results of the association assessments between each polymorphism and prevalence of hypertension. We identified a significant correlation between the –845A/G and 7119C/T polymorphisms and hypertension. The OR for hypertension of the AG+GG genotype of –845A/G was 1.42 after adjustment for confounding factors (serum triglyceride level, fasting blood sugar level, and body mass index; 95% CI: 1.10 to 1.85; P=0.008). The OR for hypertension of the TT genotype of 7119C/T was 1.37 after adjusting for triglyceride level, fasting blood sugar level, and body mass index (95% CI: 1.02 to 1.85; P=0.037; Table 3). The –366C/T and 8590T/C variants showed no significant association with hypertension.


View this table:
[in this window]
[in a new window]

 
Table 3. Genotype and Allele Distributions for Normotensive and Hypertensive Participants

Table 4 shows the linkage disequilibrium patterns for the CYP4A11 gene with |D'| and r2 values. All 4 of the SNPs were located in 1 haplotype block, because all |D'| were >0.5. In the haplotype-based case-control study, we constructed haplotypes using these 4 SNPs, because all of the r2 values were <0.5. In the haplotype-based case-control study, 4 haplotypes were established in the total group (Table 5). The frequency of the G-C-T-T form was significantly higher in the hypertensive group than in the normotensive group (P=0.0093), and the A-C-C-T haplotype frequency was significantly lower in the hypertensive group than in the normotensive group (P=0.0133). However, only the G-C-T-T haplotype was significantly associated with hypertension after adjusting for triglyceride level, fasting blood sugar level, and body mass index (OR: 1.44; 95% CI: 1.11 to 1.87; P=0.006).


View this table:
[in this window]
[in a new window]

 
Table 4. Pairwise Linkage Disequilibrium for the 4 SNPs


View this table:
[in this window]
[in a new window]

 
Table 5. Association Between the Haplotypes of CYP4A11 and Hypertension


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Recent studies have attempted to clarify human CYP4A gene (for human, CYP4A11) function as a 20-HETE synthase by pursuing the potential association between CYP4A11 and hypertension. CYP4A11 is known to be highly polymorphic, expanding the possibilities for studying the mechanism of this gene, especially as a risk factor for cardiovascular diseases.24 A product of CYP4A, 20-HETE, has been demonstrated to function in both prohypertensive and antihypertensive mechanisms. In the renal arterioles, 20-HETE may act as a strong vasoconstrictor, whereas in renal tubules, 20-HETE may attenuate sodium transport and function as a natriuretic, antihypertensive substance. Ito et al16 reported recently that CYP4A11 is highly expressed in human renal tubules and regulates 20-HETE, which is associated with the function of renal tubules and salt-sensitive hypertension.

We directly sequenced human DNA samples and identified 4 SNPs and 1 microsatellite polymorphism. In addition to the previously reported SNPs, this study identified some other specific polymorphisms in the Japanese population. Gainer et al19 reported that the 8590T/C polymorphism of CYP4A11 was functional, affecting the catalytic activity of the 20-HETE synthase. In that report, 8590C was associated with the prevalence of hypertension in 2 independent cohort studies. Gainer et al19 were likely the first to demonstrate a positive association between 8590T/C and hypertension in whites as a loss-of-function variant; the –845A/G polymorphism in the promoter region was also identified, although they did not report investigating it further.

In the current study, we selected –845A/G as a representative of the SNPs, because this polymorphism is in the promoter region and occurred at a higher allele frequency, and we focused on its functional analysis. The first finding of this study is that the –845GG genotype dramatically decreased promoter activity compared with the –845AA genotype as assessed by luciferase experiments. The second finding was that the –845GG genotype mutation of this region stimulated DNA binding in a gel mobility shift assay by an unidentified protein and potential transcription factor. When this result is coupled with the results from the luciferase assay, the implication is that the –845GG binding factor could function as a transcription repressor; thus, the –845G allele may decrease transcriptional activation of CYP4A11.

Accordingly, we used the TFMATRIX Web site (http://www.genome.jp/dbget) to determine whether the sequence including –845A/G could change the suspected transcription factor. The motif analysis extracted 1 transcription factor, cAMP-responsive element binding protein 1, which has 87% homology with the sequence including the –845G allele but 76% homology with the sequence including the –845A allele.

The third important finding of this study was the significant association between CYP4A11 gene polymorphisms and the prevalence of hypertension in a general Japanese population, warranting further investigation of the CYP4A11 gene. The –845G allele and the 7119T allele were significantly associated with hypertension even after adjustment for confounding factors, as shown in Table 3. The haplotype analysis also showed that both alleles were associated with hypertension; however, after adjustment for confounding factors, only the G-C-T-T haplotype was significantly associated with hypertension, as shown in Table 5. In addition, both polymorphisms are in the same haplotype block, and 7119C/T is a nonsynonymous polymorphism. Thus, –845A/G might be considered the susceptible polymorphism for essential hypertension in the Japanese population.

In terms of the 8590T/C polymorphism, which has been reported as a susceptible polymorphism for hypertension,19 the role of this SNP has been completely opposite in 2 different populations: the variant C allele is associated with hypertension in whites and some blacks; in contrast, the wild-type T allele associates with hypertension in a Japanese population from Tokyo. However, in the current study, 8590T/C is not associated with hypertension even by haplotype analysis in the Tanno-Sobetsu population. One of the reasons for this discrepancy is that the 8590T allele frequency is lower; in contrast, the –845G allele frequency is higher in Asians, including Japanese, than in whites. In the Tanno-Sobetsu population, which is characterized by a higher rate of high-salt intake (the average salt intake is {approx}12.6±3.6 g/d), the –845G allele might be much more associated with hypertension. In addition, the A-C-C-T and A-T-T-T haplotypes were not associated either with normotension or hypertension, and the G-C-T-T was associated with hypertension. Thus, we can conclude that there is no role for the 8590T/C SNP in hypertension in this Japanese population.

Given previous results and the results of this study, we propose the following hypothesis for the mechanism by which the –845GG genotype of CYP4A11 is involved in the etiology of hypertension. The –845G allele could result in decreased CYP4A11 expression in renal tubules compared with the wild-type –845A allele, leading to attenuated 20-HETE production. The reduced levels of 20-HETE could promote sodium reabsorption, resulting in elevated BP.

The recent report on genome-wide associations did not reveal significant associations of essential hypertension with any single marker.18 However, a positive association between CYPA411 polymorphisms and hypertension or cardiovascular diseases has been reported, and this gene has been recognized as one of the susceptible genes of hypertension on the National Center for Biotechnology Information Web site (http://www.ncbi.nlm.nih.gov). More studies are required to elucidate further the involvement of this gene in the development of hypertension.

There are 3 limitations to address in the context of the current results. First, the effect on arachidonic acid metabolism or 20-HETE production was not well investigated. In fact, we measured urine 20-HETE levels in a healthy Japanese population, and there was no difference in 20-HETE excretion among the 3 genotypes of the –845A/G polymorphism (AA, AG, and GG), although 20-HETE excretion among those with the GG genotype had a tendency to be higher than that of the other genotypes (data not shown). Thus, some further experiments are needed to clarify the effect of this polymorphism on arachidonic acid metabolism or 20-HETE production. Second, in the current study, we investigated the positive association between –845A/G and hypertension only in 1 general Japanese population. These findings should be confirmed in other populations, and we plan further investigations in the near future. Finally, we expect to try to identify the transcription factor detected as the shifted band in the gel mobility shift assay in this study. Identifying this protein could be useful for analyzing the functional mechanism of this polymorphism in the development of hypertension.

In conclusion, this study describes a functional variant in the CYP4A11, the –845A/G polymorphism, as a new candidate polymorphism for genetic susceptibility to hypertension. Our study suggests that the –845A/G polymorphism of CYP4A11 is a novel candidate for a predisposing genetic factor for hypertension via modulation of the arachidonate cascade.


*    Acknowledgments
 
We express gratitude to Kazuko Iwasa and Eriko Nagata for their continuous support of our investigations. Hiroshi Akasaka from Sapporo Medical University and Kazuaki Shimamoto, a professor of the Second Department of Internal Medicine, Sapporo Medical University, are both main staff members of the Tanno-Sobetsu Study, and their contribution was significant. We would also like to offer our appreciation to Prof Theodore W. Kurtz for his helpful and extensive advice. We are also grateful to Sayaka Ohashi, Seiko Kaji, Masafumi Kuremura, and Yasutaka Fukuda for their professional assistance with the research work.

Sources of Funding

The present study was supported by a Grant-in-Aid for Scientific Research (H17-pharmaco-common-003) from the Japanese Ministry of Health, Labor, and Welfare; Grants-in-Aid for Scientific Research (18590265, 18590811, and 19650188) from the Ministry of Education, Science, Sports and Culture of Japan; and research grants from Takeda Science Foundation, the Japan Research Foundation for Clinical Pharmacology, and the Japan Intractable Disease Research Foundation.

Disclosures

None.

Received March 28, 2008; first decision April 15, 2008; accepted September 23, 2008.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Capdevila JH, Wei S, Yan J, Karara A, Jacobson HR, Falck JR, Guengerich FP, DuBois RN. Cytochrome P-450 arachidonic acid epoxygenase. Regulatory control of the renal epoxygenase by dietary salt loading. J Biol Chem. 1992; 267: 21720–21726.[Abstract/Free Full Text]

2. Campbell WB, Harder DR. Endothelium-derived hyperpolarizing factors and vascular cytochrome P450 metabolites of arachidonic acid in the regulation of tone. Circ Res. 1999; 84: 484–488.[Free Full Text]

3. Node K, Huo Y, Ruan X, Yang B, Spiecker M, Ley K, Zeldin DC, Liao JK. Anti-inflammatory properties of cytochrome P450 epoxygenase-derived eicosanoids. Science. 1999; 285: 1276–1279.[Abstract/Free Full Text]

4. Alonso-Galicia M, Maier KG, Greene AS, Cowley AW Jr, Roman RJ. Role of 20-hydroxyeicosatetraenoic acid in the renal and vasoconstrictor actions of angiotensin II. Am J Physiol Regul Integr Comp Physiol. 2002; 283: R60–R68.[Abstract/Free Full Text]

5. Hercule H, Oyekan A. Renal cytochrome p450 oxygenases and preglomerular vascular response to arachidonic acid and endothelin-1 following ischemia/reperfusion. J Pharmacol Exp Ther. 2002; 302: 717–724.[Abstract/Free Full Text]

6. Gebremedhin D, Lange AR, Lowry TF, Taheri MR, Birks EK, Hudetz AG, Narayanan J, Falck JR, Okamoto H, Roman RJ, Nithipatikom K, Campbell WB, Harder DR. Production of 20-HETE and its role in autoregulation of cerebral blood flow. Circ Res. 2000; 87: 60–65.[Abstract/Free Full Text]

7. Sun CW, Falck JR, Harder DR, Roman RJ. Role of tyrosine kinase and PKC in the vasoconstrictor response to 20-HETE in renal arterioles. Hypertension. 1999; 33: 414–418.[Abstract/Free Full Text]

8. Hoagland KM, Flasch AK, Roman RJ. Inhibitors of 20-HETE formation promote salt-sensitive hypertension in rats. Hypertension. 2003; 42: 669–673.[Abstract/Free Full Text]

9. Oyekan AO, McGiff JC. Functional response of the rat kidney to inhibition of nitric oxide synthesis: role of cytochrome p450-derived arachidonate metabolites. Br J Pharmacol. 1998; 125: 1065–1073.[CrossRef][Medline] [Order article via Infotrieve]

10. Ito O, Alonso-Galicia M, Hopp KA, Roman RJ. Localization of cytochrome P-450 4A isoforms along the rat nephron. Am J Physiol. 1998; 274: F395–F414.[Medline] [Order article via Infotrieve]

11. Wang MH, Zhang F, Marji J, Zand BA, Nasjletti A, Laniado-Schwartzman M. CYP4A1 antisense oligonucleotide reduces mesenteric vascular reactivity and blood pressure in SHR. Am J Physiol Regul Integr Comp Physiol. 2001; 280: R255–R261.[Abstract/Free Full Text]

12. Kroetz DL, Huse LM, Thuresson A, Grillo MP. Developmentally regulated expression of the CYP4A genes in the spontaneously hypertensive rat kidney. Mol Pharmacol. 1997; 52: 362–372.[Abstract/Free Full Text]

13. Holla VR, Adas F, Imig JD, Zhao X, Price E Jr, Olsen N, Kovacs WJ, Magnuson MA, Keeney DS, Breyer MD, Falck JR, Waterman MR, Capdevila JH. Alterations in the regulation of androgen-sensitive Cyp 4a monooxygenases cause hypertension. Proc Natl Acad Sci U S A. 2001; 98: 5211–5216.[Abstract/Free Full Text]

14. Lasker JM, Chen WB, Wolf I, Bloswick BP, Wilson PD, Powell PK. Formation of 20-hydroxyeicosatetraenoic acid, a vasoactive and natriuretic eicosanoid, in human kidney. Role of Cyp4F2 and Cyp4A11. J Biol Chem. 2000; 275: 4118–4126.[Abstract/Free Full Text]

15. Powell PK, Wolf I, Jin R, Lasker JM. Metabolism of arachidonic acid to 20-hydroxy-5,8,11, 14-eicosatetraenoic acid by P450 enzymes in human liver: involvement of CYP4F2 and CYP4A11. J Pharmacol Exp Ther. 1998; 285: 1327–1336.[Abstract/Free Full Text]

16. Ito O, Nakamura Y, Tan L, Ishizuka T, Sasaki Y, Minami N, Kanazawa M, Ito S, Sasano H, Kohzuki M. Expression of cytochrome P-450 4 enzymes in the kidney and liver: regulation by PPAR and species-difference between rat and human. Mol Cell Biochem. 2006; 284: 141–148.[CrossRef][Medline] [Order article via Infotrieve]

17. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM. A chimaeric 11-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature. 1992; 355: 262–265.[CrossRef][Medline] [Order article via Infotrieve]

18. Wellcome Trust Case Control Consortium. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007; 447: 661–678.[CrossRef][Medline] [Order article via Infotrieve]

19. Gainer JV, Bellamine A, Dawson EP, Womble KE, Grant SW, Wang Y, Cupples LA, Guo CY, Demissie S, O'Donnell CJ, Brown NJ, Waterman MR, Capdevila JH. Functional variant of CYP4A11 20-hydroxyeicosatetraenoic acid synthase is associated with essential hypertension. Circulation. 2005; 111: 63–69.[Abstract/Free Full Text]

20. Mayer B, Lieb W, Gotz A, Konig IR, Aherrahrou Z, Thiemig A, Holmer S, Hengstenberg C, Doering A, Loewel H, Hense HW, Schunkert H, Erdmann J. Association of the T8590C polymorphism of CYP4A11 with hypertension in the MONICA Augsburg echocardiographic substudy. Hypertension. 2005; 46: 766–771.[Abstract/Free Full Text]

21. Mayer B, Lieb W, Gotz A, Konig IR, Kauschen LF, Linsel-Nitschke P, Pomarino A, Holmer S, Hengstenberg C, Doering A, Loewel H, Hense HW, Ziegler A, Erdmann J, Schunkert H. Association of a functional polymorphism in the CYP4A11 gene with systolic blood pressure in survivors of myocardial infarction. J Hypertens. 2006; 24: 1965–1970.[Medline] [Order article via Infotrieve]

22. Akasaka H, Katsuya T, Saitoh S, Sugimoto K, Fu Y, Takagi S, Ohnishi H, Rakugi H, Ura N, Shimamoto K, Ogihara T. Effects of angiotensin II type 1 receptor gene polymorphisms on insulin resistance in a Japanese general population: the Tanno-Sobetsu study. Hypertens Res. 2006; 29: 961–967.[Medline] [Order article via Infotrieve]

23. Dempster AP, Laird NM, Rubin DB. Maximum likelihood from in complete data via the EM algorithm. J R Stat Soc. 1977; 39: 1–22.

24. Cho BH, Park BL, Kim LH, Chung HS, Shin HD. Highly polymorphic human CYP4A11 gene. J Hum Genet. 2005; 50: 259–263.[Medline] [Order article via Infotrieve]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
52/6/1142    most recent
HYPERTENSIONAHA.108.114082v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugimoto, K.
Right arrow Articles by Rakugi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugimoto, K.
Right arrow Articles by Rakugi, H.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure
Related Collections
Right arrow Clinical genetics
Right arrow Other hypertension