Published online before print February 16, 2009, doi: 10.1161/HYPERTENSIONAHA.108.122333
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2009;53:694.)
© 2009 American Heart Association, Inc.
Original Articles |
Onset of Experimental Severe Cardiac Fibrosis Is Mediated by Overexpression of Angiotensin-Converting Enzyme 2
From the British Heart Foundation Glasgow Cardiovascular Research Centre (R.M., S.A.N., M.A.C., M.M., K.G., D.G., A.F.D., A.H.B.), Glasgow, United Kingdom; Senator Paul D. Wellstone Muscular Dystrophy Cooperative Research Centre (P.G., J.M.A., J.S.C.), University of Washington, Seattle; Faculty of Biological and Life Science (G.S.), University of Glasgow, Glasgow, United Kingdom; Sbarro Institute for Cancer Research and Molecular Medicine (C.N.), Temple University, Philadelphia, Pa; and the Department of General Pathology (C.N.), 1st School of Medicine, II University of Naples, Naples, Italy.
Correspondence to Andrew H. Baker, BHF GCRC, University of Glasgow, 126 University Place, Glasgow, G12 8TA United Kingdom. E-mail ab11f{at}clinmed.gla.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Angiotensin-converting enzyme (ACE) 2 is a recently identified homologue of ACE. There is great interest in the therapeutic benefit for ACE2 overexpression in the heart. However, the role of ACE2 in the regulation of cardiac structure and function, as well as maintenance of systemic blood pressure, remains poorly understood. In cell culture, ACE2 overexpression led to markedly increased myocyte volume, assessed in primary rabbit myocytes. To assess ACE2 function in vivo, we used a recombinant adeno-associated virus 6 delivery system to provide 11-week overexpression of ACE2 in the myocardium of stroke-prone spontaneously hypertensive rats. ACE2, as well as the ACE inhibitor enalapril, significantly reduced systolic blood pressure. However, in the heart, ACE2 overexpression resulted in cardiac fibrosis, as assessed by histological analysis with concomitant deficits in ejection fraction and fractional shortening measured by echocardiography. Furthermore, global gene expression profiling demonstrated the activation of profibrotic pathways in the heart mediated by ACE2 gene delivery. This study demonstrates that sustained overexpression of ACE2 in the heart in vivo leads to the onset of severe fibrosis.
Key Words: ACE2 • gene delivery • adeno-associated virus • hypertension • myocardium
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Overactivity of the renin-angiotensin (Ang) system plays a fundamental role in the pathophysiology of hypertension and progression of heart failure.1 Ang-converting enzyme (ACE) 2 is a recently identified homologue of ACE, and their catalytic domains share 42% amino acid identity.2–4 ACE2 expression is restricted to the heart, kidney, and testis.2,5 After myocardial infarction, increased ACE2 expression in the heart localized to vascular endothelium, smooth muscle, and cardiomyocytes in both rats and humans.6 Unlike ACE, ACE2 functions as a carboxypeptidase rather than a dipeptidyl carboxypeptidase5 and counterbalances the vasopressor effects of ACE.7 ACE2 primarily hydrolyzes Ang II and, less efficiently, Ang I,2 resulting in Ang 1-7 and Ang 1-9. Ang 1-9 is further hydrolyzed to Ang 1-7 by the actions of ACE.5 ACE inhibitors and Ang II receptor blockers are effective drugs for the treatment of cardiovascular diseases, as a result of blocking the vasoconstrictor, hypertrophic, and proinflammatory actions of Ang II.8–11 Thus, ACE2 may play a pivotal role in the renin-Ang system by reducing concentrations of Ang II and raising levels of Ang 1-7.12,13 Therefore, manipulation of ACE2 activity has potential therapeutic use. However, ACE2 knockout mice have been associated with severe contractile dysfunction14 or, conversely, with no observed effects on cardiac dimension or function.15 Overexpression of ACE2 by local delivery of lentivirus in the hearts of spontaneously hypertensive rats attenuated high blood pressure (BP) and perivascular fibrosis, reduced left ventricular (LV) wall thickness, and increased LV end diastolic and end systolic diameters.16 Conversely, transgenic overexpression of ACE2 in murine myocardium resulted in mild interstitial fibrosis and conduction disturbances leading to ventricular fibrillation, arrest, and sudden death.17
Gene delivery is a powerful approach to attenuate pathophysiological events.18 Recently, adeno-associated viruses (AAVs), in particular, AAV 6, 8, and 9, have emerged as promising cardiac gene transfer vectors.19–21 Here, we assessed the therapeutic potential of sustained overexpression of ACE2 on cardiac structure and function in stroke-prone spontaneously hypertensive rats (SHRSPs), an established recognized model of cardiovascular disease with genetic predisposition to essential hypertension and stroke sensitivity.22 Moreover, SHRSPs develop concentric LV hypertrophy23 in response to BP elevation23 that is evident at 12 weeks of age24 and also display endothelial dysfunction.25,26 It is considered a valuable model because pathophysiological similarities to human disease exists, such as local factors for stroke,27 and male SHRSPs maintain a higher BP than females.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
These studies were approved by the home office according to regulations regarding experiments with animals in the United Kingdom.
Recombinant AAV6 and Recombinant AAV9 Vector Biodistribution and Transduction Efficiencies
Male 6-week-old SHRSPs were administered a single IV injection of recombinant AAV6 (rAAV6):CMVlacZ (2x1011, 1.5x1012, and 3x1012 viral particles [VP] per rat) in the presence or absence of recombinant human vascular endothelial growth factor (VEGF)-165 (20 µg/100 g weight) or rAAV9:CMVlacZ at identical doses under general anesthesia (2% isoflurane, vol/vol). Two weeks postdelivery, DNA was extracted using the QIAmp DNA Mini kit (Qiagen). Real-time PCR was used to quantify vector genome particle number in tissue extracts. SyBr Green PCR core reagents kit (Applied Biosystems) with 200 nmol/L lacZ primers, forward (5'ATCTGACCACCAGCGAAATGG3') and reverse (5'CATCAGCAGGTGTATCTGCCG3') amplified DNA under the following conditions: 95°C, 10 minutes; 95°C, 15 seconds; 60°C, 1 minute (50 cycles); 95°C, 15 seconds; 60°C, 15 seconds; and 95°C, 15 seconds. To assess β-galactosidase expression, 6-µm sections were blocked in 20% swine serum before 1-hour incubation with anti–β-galactosidase antibody (MP Biomedicals). Sections were incubated with swine–anti-rabbit FITC antibody. For tissue and whole-limb staining, tissues were fixed in 2% paraformaldehyde before incubation in 5-bromo-4-chloro-3-indolyl β-D-galactoside stain (77 mmol/L of Na2HPO4, 23 mmol/L of NaH2PO4, 1.3 mmol/L of MgCl2, 3 mmol/L of K4Fe[CN]6, and 0.05% [vol/vol] of 20 mg/mL 5-bromo-4-chloro-3-indolyl β-D-galactoside).
Assessment of Systolic BP
Four groups of animals (n=6 per group) were included in the rAAV6:ACE2 overexpression study: PBS, enalapril, rAAV6:human placental alkaline phosphatase (control vector, as characterized previously by Odom et al28), and rAAV6:ACE2 (ACE2 cDNA was a kind gift from Mohan Raizada). Male 8-week-old SHRSPs received 3x1012 vp of either rAAV6:human placental alkaline phosphatase (hPLAP) or rAAV6:ACE2. Control animals were infused with 200 µL of PBS, and enalapril was supplied in the drinking water at 0.1 mg/mL. Systolic BP monitoring was carried out weekly by computerized tail-cuff plethysmography.24
Assessment of Cardiac Structure and Function by Echocardiography
Transthoracic echocardiography was performed using an Acuson Sequoia c512 ultrasound system with a 15-MHz linear array transducer. 2-D guided M-mode images at a 2-mm depth were recorded at the tip of papillary muscles. Posterior and anterior wall thicknesses of the LV chamber and its diameter during systole and diastole were measured in short-axis view using leading edge-to-leading edge convention. All of the parameters were measured over 
3 consecutive cardiac cycles. Ejection fraction was defined as follows: ejection fraction=[(LVEDV–LVESV)/LVESDx100], where LVEDV is LV end diastolic volume, LVESV is LV end systolic volume, and LVESD is LV end systolic diameter. Fractional shortening was derived as follows: fractional shortening=[(LVEDD–LVESD)/LVEDDx100], where LVEDD is LV end diastolic diameter. Cardiac output was derived as follows: cardiac output=[(ESV–EDV)xHR], where ESV is end systolic volume, EDV is end diastolic volume, and HR is heart rate.
Histological Analysis Postmortem
Formalin-fixed, paraffin-embedded tissue sections (6 µm) were deparaffinized and rehydrated through alcohol and stained with hematoxylin and eosin. For ACE2, sections were incubated with rabbit anti-ACE2 antibody or matched rabbit IgG nonimmune control (Dako) then detected with biotinylated universal secondary antibodies (1:200), ABC kit, and standard diaminobenzidine staining. For immunofluorescence, heart sections were dual stained with ACE2 and 
-sarcomeric actin and detected with goat antirabbit FITC (green) and goat antimouse Alexa 633 (red), respectively. For Picrosirius Red, sections were incubated in Sirius Red F3B (0.1% wt/vol saturated picric acid), washed in 0.01 N HCl, and distilled H2O. Masson’s trichrome stain kit (Sigma) was used. For quantification of staining, pixel intensity was measured using Image Pro-Plus software using methods described previously.29
Statistical Analysis
Comparisons were made using 1-way ANOVA. Statistical analysis was performed in Prism version 4.0 (Graph Pad Software). For all of the tests, P<0.05 is statistically significant following Bonferroni or Tukey’s posthoc analysis, and results represent mean values and SEM of the data. Cell measurements were analyzed using the Student t test.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In Vitro Assessment of Myocyte Structure
We first assessed the effects of ACE2 overexpression on the structure of isolated primary rabbit myocytes. Adenovirus-mediated gene transfer was used in vitro, because rAAV6 does not transduce myocytes in vitro and induce transgene expression in the necessary time frame because of the requirement for second-strand synthesis. ACE2 was efficiently expressed by Ad5 in isolated rabbit myocytes and resulted in a marked increase in cell hypertrophy (Figure S1A through S1C, available in the online data supplement at http://hyper.ahajournals.org).
rAAV6 and rAAV9 Vector Biodistribution and Transduction Profiles in SHRSPs After Intravascular Delivery
We determined the capacity of rAAV6 and rAAV9 vectors to transduce the SHRSP heart after a single systemic injection. Both vectors were efficient, and rAAV6-mediated gene transfer was not modified by VEGF coadministration (Figure 1A and 1B). Levels of gene expression mediated by rAAV6 in mice had previously been found to be enhanced by VEGF coadministration.30 Biodistribution studies were carried out (Figure S2), and vector genomes were quantified by TaqMan and revealed marked differences in vector genome accumulation (Figure 1C). Furthermore, biodistribution of rAAV9-packaged genomes to the kidney was far higher than rAAV6. We, therefore, proceeded with rAAV6 for delivery of ACE2 to the myocardium of SHRSPs in vivo.
|
Effect on BP
To be packaged into rAAV6 vectors, the ACE2 gene was cloned into an AAV shuttle plasmid and tested for functional expression of the ACE2 gene in COS7 cells (Figure S3). Male rats were injected with rAAV6:ACE2, control vectors, or PBS at 8 weeks of age. A previous study indicated a potentially beneficial effect of ACE2 overexpression on BP.16 We, therefore, analyzed BP after in vivo ACE2 gene transfer. Enalapril treatment was included as a positive control for BP measurements. PBS and rAAV6:hPLAP control animals showed an equivalent increase in BP over time, characteristic of SHRSP (Figure S4). This rise in systolic BP was significantly attenuated by enalapril and by ACE2 overexpression (P<0.001). The effects of ACE2 overexpression were especially evident at later time points after injection (Figure S4).
Effect of ACE2 Overexpression on In Vivo Cardiac Function
Our principle aim was to document the effect of long-term ACE2 overexpression on cardiac function during the establishment of hypertension and LV hypertrophy in the SHRSP, which is evident at 12 weeks of age.24 Cardiac function was monitored by echocardiography over the following 11 weeks. LV M-mode echocardiography demonstrated a change in LV diameter and reduction in wall thickness at 4, 8, and 11 weeks postinfusion with reduced systolic function in the rAAV6:ACE2 vector–infused animals compared with PBS, enalapril, and rAAV6:hPLAP vector–infused rats (Figure 2A). M-mode images were used to define wall thicknesses and internal diameters at systole and diastole. Rats treated with rAAV6:ACE2 exhibited a significant (28%) reduction in ejection fraction and also in fractional shortening compared with controls (Table S1 and Figure 2B and 2C). As expected, cardiac output increased with age and body mass in control SHRSPs (Table S1 and Figure 2D). However, no change in cardiac output occurred in rAAV6:ACE2-treated rats (Figure 2D). Furthermore, systolic BP/end systolic volume ratio demonstrated that the rAAV6:ACE2-treated SHRSP showed decreased LV performance (Figure 2E). Interventricular septal wall thickness decreased by 14% in the rAAV6:ACE2 group. There was minimal effect on wall thickness in the rAAV6:hPLAP and PBS groups, and LV mass index did not significantly differ between groups (Figure S5 and Table S1). Echocardiography studies, therefore, revealed that ACE2 overexpression leads to a significant reduction in cardiac function compared with control groups.
|
Histological Evaluation of Cardiac Structure
Sustained overexpression of ACE2 in rats receiving rAAV6:ACE2 was confirmed at 11 weeks postinjection (Figure 3A). ACE2 overexpression in the heart was colocalized with -sarcomeric actin expression, confirming that ACE2 overexpression occurred selectively in cardiac myocytes (Figure 3B). ACE2 mRNA was also shown to be upregulated in the hearts of rAAV6:ACE2-treated animals in comparison with rAAV6:hPLAP controls (Figure S6). Clear evidence of cardiac dysregulation in ACE2-expressing hearts was observed with irregular myocyte shape (Figure 3C). The effect of ACE2 on cardiac fibrosis was assessed by Picrosirius Red (Figure 3C) and Masson’s trichrome stain (Figure 3C). Myocardial interstitial fibrosis was only observed in the ACE2-expressing SHRSPs (Figure 3C), correlating with the increased expression of collagen I and III in the hearts of rAAV6:ACE2-transduced rats only (Figure S7A and S7B). Expression of gap junction protein connexin 43 was detected between myocytes in all of the groups (Figure 3C). The pattern of connexin 43 staining confirmed the disrupted myocardial organization present in the rAAV6:ACE2-infused animals that was apparent in the hematoxylin and eosin sections (Figure 3C). Endothelial staining with rat endothelial cell marker RECA-1 revealed no obvious evidence of increased angiogenesis in ACE2-treated rats (Figure 3C). Although expression of Ang II was not seen to alter significantly between groups, Ang 1-7 expression was significantly increased in the rAAV6:ACE2-transduced group (Figures 4A, 4B, S7A, and S7B). Collagen I and III expression levels were both significantly increased in the rAAV6:ACE2-transduced group (Figures 4C, 4D, S7C, and S7D). No evidence of increased cardiac apoptosis was found in the hearts of rAAV6:ACE2-transduced animals at the 3-month time point (Figure S8). In assessment of ACE and ACE2 activity in heart lysates from rAAV6:ACE2-transduced animals, ACE2 activity was greater than ACE activity, and both were blocked by incubation with their specific inhibitors (data not shown).
|
|
Global Gene Expression Profiling
To assess transcriptional activity in the hearts of animals overexpressing ACE2, we performed gene expression profiling using Illumina expression arrays on animals terminated at 4 weeks postgene transfer. Microarray analysis revealed activation of a profibrotic phenotype at the transcriptional level in ACE2 animals. Fibrosis-associated genes, including collagen type III1, fibronectin 1, and lysyl oxidase, were upregulated (Table S2 and Figure S9). Furthermore, genes implicated in the maintenance of cardiac function, including apelin, myosin heavy chain 11, and GATA binding protein 6, were found to be downregulated (Table S2 and Figure S9). The regulation of integrin β2, fibronectin 1, and myosin heavy chain 11 was assessed in the hearts of rAAV6:ACE2-transduced SHRSPs in comparison with rAAV6:hPLAP-transduced SHRSPs (Figure S10A through S10C). Gene expression data correlated with the pathway shown in Figure S9. These data confirm the activation of transcriptional pathways defining profibrotic effects mediated by myocardial ACE2 delivery in vivo.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In the present study, we demonstrate that efficient and sustained (11-week) rAAV6-mediated ACE2 overexpression in myocardium of SHRSPs exerts detrimental effects on cardiac structure and function while lowering BP. Myocardial changes were characterized by morphological adaptations including severe myocardial interstitial and perivascular fibrosis, an increase in collagen content, and abnormal myocardial organization. The effects of ACE2 overexpression were presumed to be a direct effect on cardiomyocytes as rAAV6 mediates selective gene delivery to cardiomyocytes, confirmed by biodistribution studies and ACE2 expression colocalization studies. However, a disruption in the communication between myocytes and cardiac fibroblasts cannot be ruled out as a potential interaction pertinent to the development of the observed phenotype.
Cardiomyocytes could not be isolated from the hearts of rAAV6:ACE2-transduced SHRSPs to assess hypertrophy at the single-cell level, because the degree of fibrosis made the process of isolation too severe for myocyte survival. However, in vitro studies confirmed that ACE2 overexpression leads to cardiomyocyte hypertrophy. The pivotal role of Ang II in hypertension and LV hypertrophy is well documented. Studies in ACE2-deficient mice15 showed an increase in systolic BP and elevated plasma levels of Ang II, indicating that ACE2 is key in the metabolism of Ang II. At present, however, the role of ACE2 in the renin-Ang system remains ambiguous. Previous ACE2 intervention studies in mice or rats16 have shown conflicting results. Crackower et al14 proposed ACE2 as an essential regulator of heart function. The loss of ACE2 in mice resulted in severe cardiac contractility defects and an increase in Ang II levels, indicating that ACE2 controls levels of Ang II in vivo.14 In a separate study, ACE2 gene transfer resulted in significant attenuation of high BP and cardiac fibrosis in the spontaneously hypertensive rat.16 However, Donoghue et al17 showed that transgenic mice with increased cardiac ACE2 expression displayed a high incidence of sudden death. In the present study, transduction of cardiomyocytes with both low and high doses of Ad5:ACE2 led to an increase in cell volume. Recently, it has been shown that ACE2 overexpression, followed by permanent coronary artery ligation in rats, resulted in cardiac function preservation.31 The BP data in this present study correlate with that of studies in which ACE2 was overexpressed via lentiviral vector delivery.16 However, it is unlikely to have occurred via the same mechanism. Using lentiviral vectors,16 expression of ACE2 after intracardiac injection was shown to occur in the kidney through systemic leakage of the vector, whereas the biodistribution patterns of our vector show no evidence of substantial expression in the kidney. Therefore, attenuation of high BP in the spontaneously hypertensive rat could be because of beneficial effects of ACE2 acting directly to metabolize Ang II into Ang 1-7 in the kidney. The high BP attenuation in the present study could be explained by a beneficial effect of ACE2 acting on the peripheral circulation, because the expression of ACE2 in our study is not limited to the myocardium. This effect could be mediated either as an effect of activation of the Ang 1-7 Mas receptor, which mediates endothelial NO synthase activation and, thus, NO release,32 or indirectly as a consequence of reduced Ang II levels, because Ang II has been shown to activate NAD(P)H oxidases, resulting in reactive oxygen species production, which inactivates NO.33,34 However, severe cardiac dysfunction and fibrosis may have lowered BP as a result of diastolic and systolic abnormalities generating cardiac decompensation. Cardiac dysfunction is present from 4 weeks postinfusion, whereas significance in BP differences occurs from 7 weeks postinfusion, suggesting that the underlying cardiac dysfunction precedes the lowered BP.
In the study most akin to that described here, local cardiac delivery of a lentiviral vector overexpressing ACE2 resulted in transduction levels of >50% in some areas of the myocardium but to <5% in other areas.16 Although studies using lentiviral vectors reported reduced BP and beneficial effects on cardiac fibrosis, it is plausible that ACE2 expression levels were not as high as in the present study. Thus, lower ACE2 levels may produce cardioprotective effects while avoiding the induction of detrimental effects on the heart. Transgene dose effects are supported by the occurrence of sudden death earlier in the high ACE2-expressing transgenic mouse line than in the lower-expressing line.17
Onset of transgene expression from AAV6 in rat has been reported to be evident from 1 week postgene delivery, significantly increasing by 4 weeks and maximal by 12 weeks postgene delivery.35 The temporal profile of rAAV6:ACE2 expression thus correlates with the echocardiography data in the present study, with deterioration of cardiac function being visible at 4 weeks postinfusion and greatest at the end point of 11 weeks postinfusion.
The hearts of the rAAV6:ACE2-treated animals in the present study showed a reduction in ejection fraction and fractional shortening, a decrease in interventricular wall thickness, a decrease in systolic BP/end systolic volume ratio, and no increase in cardiac output overtime, along with histological evidence of severe fibrosis. All of these phenotypes are consistent with severe cardiac dysfunction progressing toward heart failure. This is in agreement with the transgenic mouse study, which also found that overexpression of ACE2 resulted in profound cardiac dysfunction and mild cardiac fibrosis.17 Cardiac fibrosis is a marker of cardiac failure and contributes to ventricular wall stiffness, impairing cardiac relaxation resulting in impaired ventricular filling and abnormal diastolic function.36–38 The pathogenesis of heart failure inevitably proceeds to dilated cardiomyopathy, in which heart chambers become markedly enlarged and contractile function deteriorates. In early stages, cardiac enlargement is an adaptive process to maintain cardiac output. However, as the heart overcompensates for declining systolic performance, dilation becomes a pathological process. Dilation in the present study, along with decreased wall thickness, would account for the lack of change in LV mass index in the ACE2-transduced SHRSP.
Perspectives
In conclusion, our data demonstrate the development of severe cardiac abnormalities associated with sustained ACE2 overexpression in vivo. Increased expression may result in loss of function of cardioprotective mechanisms. Additional work should address the extent to which these effects are correlated to the ACE2 expression levels to determine whether beneficial effects can be obtained with reduced expression levels or whether the increased expression of ACE2 at any level is deleterious for cardiac morphology and function.
|
Acknowledgments |
|---|
We thank Nicola Britton for invaluable help in BP studies and Elisabeth Beattie for invaluable help in echocardiogaphy studies.
Source of Funding
This work was supported by the British Heart Foundation (PG/07/015/22372).
Disclosures
None.
Received August 29, 2008; first decision September 21, 2008; accepted January 15, 2009.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Zaman MA, Oparil S, Calhoun DA. Drugs targeting the renin-angiotensin-aldosterone system. Nat Rev Drug Discov. 2002; 1: 621–636.[CrossRef][Medline] [Order article via Infotrieve]
2. Tipnis SR, Hooper NM, Hyde R, Karran E, Christie G, Turner AJ. A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem. 2000; 275: 33238–33243.
3. Soubrier F, Alhenc-Gelas F, Hubert C, Allegrini J, John M, Tregear G, Corvol P. Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. Proc Natl Acad Sci U S A. 1988; 85: 9386–9390.
4. Ehlers MR, Riordan JF. Angiotensin-converting enzyme: zinc- and inhibitor-binding stoichiometries of the somatic and testis isozymes. Biochemistry. 1991; 30: 7118–7126.[CrossRef][Medline] [Order article via Infotrieve]
5. Donoghue M, Hsieh F, Baronas E, Godbout K, Gosselin M, Stagliano N, Donovan M, Woolf B, Robison K, Jeyaseelan R, Breitbart RE, Acton S. A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circ Res. 2000; 87: E1–E9.[Medline] [Order article via Infotrieve]
6. Burrell LM, Risvanis J, Kubota E, Dean RG, MacDonald PS, Lu S, Tikellis C, Grant SL, Lew RA, Smith AI, Cooper ME, Johnston CI. Myocardial infarction increases ACE2 expression in rat and humans. Eur Heart J. 2005; 26: 369–375,discussion 322–364.
7. Vickers C, Hales P, Kaushik V, Dick L, Gavin J, Tang J, Godbout K, Parsons T, Baronas E, Hsieh F, Acton S, Patane M, Nichols A, Tummino P. Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem. 2002; 277: 14838–14843.
8. Levy S. Drug insight: angiotensin-converting-enzyme inhibitors and atrial fibrillation–indications and contraindications. Nat Clin Pract Cardiovasc Med. 2006; 3: 220–225.[CrossRef][Medline] [Order article via Infotrieve]
9. Kober L, Torp-Pedersen C. Do ACE inhibitors improve outcome in patients with stable vascular disease? Nat Clin Pract Cardiovasc Med. 2007; 4: 124–125.[CrossRef][Medline] [Order article via Infotrieve]
10. McMurray JJ. Val-HeFT: do angiotensin-receptor blockers benefit heart failure patients already receiving ACE inhibitor therapy? Nat Clin Pract Cardiovasc Med. 2005; 2: 128–129.[CrossRef][Medline] [Order article via Infotrieve]
11. Gupta M, Lonn EM, Verma S. Should patients with stable coronary artery disease be treated with ACE inhibitor therapy? Nat Clin Pract Cardiovasc Med. 2005; 2: 124–125.[CrossRef][Medline] [Order article via Infotrieve]
12. Ferrario CM, Chappell MC, Tallant EA, Brosnihan KB, Diz DI. Counterregulatory actions of angiotensin-(1-7). Hypertension. 1997; 30: 535–541.
13. Ferrario CM. Angiotension-(1-7) and antihypertensive mechanisms. J Nephrol. 1998; 11: 278–283.[Medline] [Order article via Infotrieve]
14. Crackower MA, Sarao R, Oudit GY, Yagil C, Kozieradzki I, Scanga SE, Oliveira-dos-Santos AJ, da Costa J, Zhang L, Pei Y, Scholey J, Ferrario CM, Manoukian AS, Chappell MC, Backx PH, Yagil Y, Penninger JM. Angiotensin-converting enzyme 2 is an essential regulator of heart function. Nature. 2002; 417: 822–828.[CrossRef][Medline] [Order article via Infotrieve]
15. Gurley SB, Allred A, Le TH, Griffiths R, Mao L, Philip N, Haystead TA, Donoghue M, Breitbart RE, Acton SL, Rockman HA, Coffman TM. Altered blood pressure responses and normal cardiac phenotype in ACE2-null mice. J Clin Invest. 2006; 116: 2218–2225.[CrossRef][Medline] [Order article via Infotrieve]
16. Diez-Freire C, Vazquez J, Correa de Adjounian MF, Ferrari MF, Yuan L, Silver X, Torres R, Raizada MK. ACE2 gene transfer attenuates hypertension-linked pathophysiological changes in the SHR. Physiol Genomics. 2006; 27: 12–19.[CrossRef][Medline] [Order article via Infotrieve]
17. Donoghue M, Wakimoto H, Maguire CT, Acton S, Hales P, Stagliano N, Fairchild-Huntress V, Xu J, Lorenz JN, Kadambi V, Berul CI, Breitbart RE. Heart block, ventricular tachycardia, and sudden death in ACE2 transgenic mice with downregulated connexins. J Mol Cell Cardiol. 2003; 35: 1043–1053.[CrossRef][Medline] [Order article via Infotrieve]
18. Baker AH, Sica V, Work LM, Williams-Ignarro S, de Nigris F, Lerman LO, Casamassimi A, Lanza A, Schiano C, Rienzo M, Ignarro LJ, Napoli C. Brain protection using autologous bone marrow cell, metalloproteinase inhibitors, and metabolic treatment in cerebral ischemia. Proc Natl Acad Sci U S A. 2007; 104: 3597–3602.
19. Inagaki K, Fuess S, Storm TA, Gibson GA, McTiernan CF, Kay MA, Nakai H. Robust systemic transduction with AAV9 vectors in mice: efficient global cardiac gene transfer superior to that of AAV8. Mol Ther. 2006; 14: 45–53.[CrossRef][Medline] [Order article via Infotrieve]
20. Wang Z, Zhu T, Qiao C, Zhou L, Wang B, Zhang J, Chen C, Li J, Xiao X. Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart. Nat Biotechnol. 2005; 23: 321–328.[CrossRef][Medline] [Order article via Infotrieve]
21. Pacak CA, Mah CS, Thattaliyath BD, Conlon TJ, Lewis MA, Cloutier DE, Zolotukhin I, Tarantal AF, Byrne BJ. Recombinant adeno-associated virus serotype 9 leads to preferential cardiac transduction in vivo. Circ Res. 2006; 99: e3–e9.
22. Gratton JA, Sauter A, Rudin M, Lees KR, McColl J, Reid JL, Dominiczak AF, Macrae IM. Susceptibility to cerebral infarction in the stroke-prone spontaneously hypertensive rat is inherited as a dominant trait. Stroke. 1998; 29: 690–694.
23. Ohtaka M. Stroke-prone SHR (SHRSP) as models for clinical and epidemiological studies on hypertension-related cardiac diseases in humans. Jpn Circ J. 1980; 44: 347–360.[Medline] [Order article via Infotrieve]
24. Davidson AO, Schork N, Jaques BC, Kelman AW, Sutcliffe RG, Reid JL, Dominiczak AF. Blood pressure in genetically hypertensive rats. Influence of the Y chromosome. Hypertension. 1995; 26: 452–459.
25. McIntyre M, Hamilton CA, Rees DD, Reid JL, Dominiczak AF. Sex differences in the abundance of endothelial nitric oxide in a model of genetic hypertension. Hypertension. 1997; 30: 1517–1524.
26. Kerr S, Brosnan MJ, McIntyre M, Reid JL, Dominiczak AF, Hamilton CA. Superoxide anion production is increased in a model of genetic hypertension: role of the endothelium. Hypertension. 1999; 33: 1353–1358.
27. Yamori Y, Horie R, Handa H, Sato M, Fukase M. Pathogenetic similarity of strokes in stroke-prone spontaneously hypertensive rats and humans. Stroke. 1976; 7: 46–53.
28. Odom GL, Gregorevic P, Chamberlain JS. Viral-mediated gene therapy for the muscular dystrophies: successes, limitations and recent advances. Biochim Biophys Acta. 2007; 1772: 243–262.[Medline] [Order article via Infotrieve]
29. Hoffman RM, Yang M. Whole-body imaging with fluorescent proteins. Nat Protoc. 2006; 1: 1429–1438.[CrossRef][Medline] [Order article via Infotrieve]
30. Gregorevic P, Blankinship MJ, Allen JM, Crawford RW, Meuse L, Miller DG, Russell DW, Chamberlain JS. Systemic delivery of genes to striated muscles using adeno-associated viral vectors. Nat Med. 2004; 10: 828–834.[CrossRef][Medline] [Order article via Infotrieve]
31. Der Sarkissian S, Grobe JL, Yuan L, Narielwala DR, Walter GA, Katovich MJ, Raizada MK. Cardiac overexpression of angiotensin converting enzyme 2 protects the heart from ischemia-induced pathophysiology. Hypertension. 2008; 51: 712–718.
32. Sampaio WO, Souza dos Santos RA, Faria-Silva R, da Mata Machado LT, Schiffrin EL, Touyz RM. Angiotensin-(1–7) through receptor Mas mediates endothelial nitric oxide synthase activation via Akt-dependent pathways. Hypertension. 2007; 49: 185–192.
33. Griendling KK, Minieri CA, Ollerenshaw JD, Alexander RW. Angiotensin II stimulates NADH and NADPH oxidase activity in cultured vascular smooth muscle cells. Circ Res. 1994; 74: 1141–1148.
34. Zhang H, Schmeisser A, Garlichs CD, Plotze K, Damme U, Mugge A, Daniel WG. Angiotensin II-induced superoxide anion generation in human vascular endothelial cells: role of membrane-bound NADH-/NADPH-oxidases. Cardiovasc Res. 1999; 44: 215–222.
35. Palomeque J, Chemaly ER, Colosi P, Wellman JA, Zhou S, Del Monte F, Hajjar RJ. Efficiency of eight different AAV serotypes in transducing rat myocardium in vivo. Gene Ther. 2007; 14: 989–997.[CrossRef][Medline] [Order article via Infotrieve]
36. Brilla CG, Janicki JS, Weber KT. Impaired diastolic function and coronary reserve in genetic hypertension. Role of interstitial fibrosis and medial thickening of intramyocardial coronary arteries. Circ Res. 1991; 69: 107–115.
37. Doering CW, Jalil JE, Janicki JS, Pick R, Aghili S, Abrahams C, Weber KT. Collagen network remodelling and diastolic stiffness of the rat left ventricle with pressure overload hypertrophy. Cardiovasc Res. 1988; 22: 686–695.
38. Jalil JE, Doering CW, Janicki JS, Pick R, Shroff SG, Weber KT. Fibrillar collagen and myocardial stiffness in the intact hypertrophied rat left ventricle. Circ Res. 1989; 64: 1041–1050.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||