Published online before print April 6, 2009, doi: 10.1161/HYPERTENSIONAHA.108.128165
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Hypertension. 2009;53:782.)
© 2009 American Heart Association, Inc.
Original Articles |
Swimming Prevents Vulnerable Atherosclerotic Plaque Development in Hypertensive 2-Kidney, 1-Clip Mice by Modulating Angiotensin II Type 1 Receptor Expression Independently From Hemodynamic Changes
From the Service of Vascular Medicine (M.P., J.-F.A., K.B., D.H., J.N., L.M.) and Service of Internal Medicine (F.A., J.-A.H.), Lausanne University Hospital, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland; EA-4267/2SBP (A.B., P.L.), Exercise Prevention Innovation and Technico-Sporting Watching Department, University of Franche-Comté, Besançon, France; Division of Cardiology (V.B., F.M.), University Hospital, Foundation for Medical Researches, Geneva, Switzerland; and the Department of Internal Medicine (D.H.), Hôpital Cantonal, Fribourg, Switzerland.
Correspondence to Lucia Mazzolai or Maxime Pellegrin, Service of Vascular Medicine, CHUV, Av Pierre Decker 5, 1011 Lausanne, Switzerland. E-mail lucia.mazzolai{at}chuv.ch or maxime.pellegrin@chuv.ch
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Exercise is known to reduce cardiovascular risk. However, its role on atherosclerotic plaque stabilization is unknown. Apolipoprotein E–/– mice with vulnerable (2-kidney, 1-clip: angiotensin [Ang] II–dependent hypertension model) or stable atherosclerotic plaques (1-kidney, 1-clip: Ang II–independent hypertension model and normotensive shams) were used for experiments. Mice swam regularly for 5 weeks and were compared with sedentary controls. Exercised 2-kidney, 1-clip mice developed significantly more stable plaques (thinner fibrous cap, decreased media degeneration, layering, macrophage content, and increased smooth muscle cells) than sedentary controls. Exercise did not affect blood pressure. Conversely, swimming significantly reduced aortic Ang II type 1 receptor mRNA levels, whereas Ang II type 2 receptor expression remained unaffected. Sympathetic tone also significantly diminished in exercised 2-kidney, 1-clip mice compared with sedentary ones; renin and aldosterone levels tended to increase. Ang II type 1 downregulation was not accompanied by improved endothelial function, and no difference in balance among T-helper 1, T-helper 2, and T regulatory cells was observed between sedentary and exercised mice. These results show for the first time, in a mouse model of Ang II–mediated vulnerable plaques, that swimming prevents atherosclerosis progression and plaque vulnerability. This benefit is likely mediated by downregulating aortic Ang II type 1 receptor expression independent from any hemodynamic change. Ang II type 1 downregulation may protect the vessel wall from the Ang II proatherogenic effects. Moreover, data presented herein further emphasize the pivotal and blood pressure–independent role of Ang II in atherogenesis.
Key Words: hypertension • vulnerable plaque • angiotensin • atherosclerosis • swimming
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Atherosclerosis, a complex multifactorial chronic disease, represents a major health burden in modern society. A number of risk factors are strongly associated with the initiation and growth of atherosclerotic plaques. However, the mechanisms that cause a stable plaque to become vulnerable remain largely unknown. We have shown recently, in a mouse model of atherosclerosis, that angiotensin (Ang) II induces the progression of atherosclerosis and mediates plaque vulnerability beyond its effect on blood pressure.1 Progression toward a vulnerable phenotype facilitates plaque rupture with dramatic consequences.2,3 Therefore, stabilizing atherosclerotic plaques is a major goal in cardiovascular medicine. Regular physical exercise is effective and efficient in reducing cardiovascular risk.4–6 In particular, exercise has been shown to reduce the progression of atherosclerosis in patients with coronary artery disease.7 Similarly, we and others have shown that regular exercise exerts a beneficial effect on atherosclerosis extension in a variety of animal models.8–11 It is, therefore, not surprising that many national and international guidelines now consider regular aerobic exercise for
30 minutes per day, most days of the week, to be a key element in the management of cardiovascular risk reduction. Swimming is considered equally effective as jogging, biking, or walking as a recommended aerobic exercise. However, although exercise has undoubtedly beneficial effects on cardiovascular risk reduction, little is known as to whether exercise and, in particular, swimming, may have an impact on atherosclerotic plaque progression/stabilization. Therefore, the aim of this study was to assess a putative beneficial effect of regular swimming on vulnerable plaque development. For this purpose, the mouse model of Ang II–mediated vulnerable plaque, developed in our laboratory,1 was used. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mouse Models of Stable and Vulnerable Atherosclerotic Plaques
Apolipoprotein E (ApoE)–/– mice (C57BL/6J background, IFFA CREDO, L’Arbresle Cedex, France) were fed regular rodent chow and water ad libitum throughout the study. Both male and female mice were used. All of the experiments were approved by the local institutional animal committee. Two models of renovascular hypertension were generated as described previously in 14- to 16-week-old animals: the renin-dependent Ang II–mediated 2-kidney, 1-clip (2K1C; these mice develop vulnerable plaques, as reported previously1) and the renin-independent 1-kidney, 1-clip (1K1C; these mice develop stable plaques1). Briefly, mice were anesthetized by halothane inhalation (1% to 2% in oxygen), the left kidney was exposed, and the left renal artery was clipped to reduce renal perfusion. In the 1K1C model, other than left renal artery clipping, a right nephrectomy was performed. Normotensive sham ApoE–/– animals were used as controls.
Endurance Swimming Protocol
ApoE–/– mice were randomly assigned to either the sedentary or exercise group. The exercise group underwent a 5-week swimming program, as published previously.10 Briefly, swimming was always performed in the morning between 8 and 10 AM. It consisted of a swimming period of 50 minutes per day, 5 days per week in water constantly kept at 35°C to 36°C. Animals were progressively trained before clipping: 10 minutes of training on day 1, followed by daily 10-minute increases up to 40 minutes of training on day 4. On day 5, mouse models of stable or vulnerable plaques were generated as described above. After surgery, mice were allowed to recover for 2 days. Swimming training was then resumed at 50 minutes per day, 5 days per week for 5 weeks. After swimming sessions, wet animals were carefully dried and placed in a warm environment to avoid additional cold physiological stress and health problems.
Blood Pressure and Heart Rate
Mean blood pressure (MBP) and heart rate (HR) were measured 5 weeks after clipping at the end of the experimental protocol in the 6 groups of mice (sedentary and exercised sham, 2K1C and 1K1C ApoE–/– mice), as described previously.1 Briefly, the left carotid artery was catheterized, and the catheter was tunneled subcutaneously to exit at the back of the neck. Mice were allowed full recovery from anesthesia. The arterial line was connected to a pressure transducer and 30 to 45 minutes, and thereafter, MBP, systolic and diastolic pressures, and HR were recorded using a computerized data acquisition system.12
Hormones, Total Cholesterol, Citrate Synthase, and Plasma Interleukin 6 Measurements
At the end of the experimental period, right after blood pressure measurement, blood was drawn (100 µL) from nonanesthetized mice via the arterial catheter into EDTA-containing tubes. Plasma renin concentration (PRC) and angiotensinogen (Ang-N) plasma levels were determined as described previously using a modified microassay based on angiotensin I trapping by antibody developed in our laboratory.13 Plasma norepinephrine (NE) levels were measured as described previously.14 Briefly, blood was gently drawn via the arterial catheter connected to a long (30-cm) phycoerythrin 10 tube into heparin-containing tubes. Plasma NE was determined using a modified high-performance liquid chromatography with amperometric detection technique. Plasma aldosterone levels were measured by direct radioimmunoassay, as described previously.15 Total cholesterol in mouse plasma was measured using a commercially available kit (DiaSys Diagnostic Systems GmbH) following the manufacturer’s instructions. Citrate synthase activity, a marker of mitochondrial content, was measured in gastrocnemius muscle homogenates using a spectrophotometric method, as described previously.10 Plasma interleukin 6 was measured using an ELISA kit following the manufacturer’s instructions (Quantikine R&D).
Evaluation of Atherosclerotic Plaque Vulnerability and Morphology
Analyses of plaque morphology and morphometry were carried out in 3-µm-thick serial histological sections of formol-fixed and paraffin-embedded aortic sinuses, as described previously.1 Sections obtained between the appearance and disappearance of the aortic valve were analyzed by light microscopy for the identification of plaques. The 3 middle sections of the biggest atherosclerotic plaque were used for atherosclerotic evaluation after staining with Movats pentachrome. The preceding and following 3-µm-thick sections were used for immunohistochemistry. An independent investigator blinded to the study protocol evaluated each section under a light microscopy using the morphometry software Qwin (Leica Systems). After Movats staining, plaques were classified as early intermediate (essentially composed of foam cells or with a small lipid core) and advanced (large necrotic/lipid core with multiple layers). Furthermore, the following characteristics of plaque quality were evaluated: (1) fibrous cap thickness; (2) quantification of smooth muscle cell (SMC) content (
-smooth muscle actin staining); (3) presence of media degeneration (invasion of media by plaque components, media thinning, elastic laminae rupture, and media atrophy); (4) presence of layering (foam cells above or adjacent to the central lipid core); (5) inflammation of the adventitia (>20 polymorphonuclear cells); and (6) plaque macrophage content quantification (staining).1 Plaque surface at the aortic valve level was measured in stained Movats sections using the morphometry software Qwin (Leica Systems).
Immunohistochemical Analysis
Analysis was carried out as described previously.1 Briefly, sections were stained with a biotinylated mouse monoclonal IgG2a -smooth muscle actin antibody16 or with a monoclonal antibody to mouse macrophage marker Mac-2 (clone M3/38, Cedarlane). Samples were observed with a photomicroscope, and pictures were acquired with a high-sensitivity color digital camera (Leica DC Camera, Leica Systems). -Smooth muscle actin and Mac-2–positive areas were quantified by means of the Qwin morphometry software.1
Ex Vivo Endothelial Function Assessment
Aortas of mice were excised, cleaned from connective tissue, and cut into rings of 
2 mm in length. Each ring was suspended between wires attached to force transducers in a Multi Myograph System (model 610M) for the measurement of isometric tension. Rings were incubated in a chamber filled with Krebs solution (NaCl 118 mmol/L, KCl 4.65 mmol/L, CaCl2 2.5 mmol/L, KH2PO4 1.18 mmol/L, NaHCO3 24.9 mmol/L, MgSO4 1.18 mmol/L, and glucose 12 mmol/L [pH 7.4]) bubbled with 95% O2-5% CO2 at 37°C (pH 7.4) and allowed to stabilize for 60 minutes at 3 to 4 mN optimal resting tension. To study endothelial function, the vasodilator responses to the endothelium-dependent agonist acetylcholine (3x10–9 to 10–5 mol/L) and endothelium-independent agonist sodium nitroprusside (3x10–9 to 10–5 mol/L) were studied. The degree of vasodilatation was expressed as the percentage reduction from the precontracted state induced by 10–5 mol/L of phenylephrine.
Real-Time Semiquantitative PCR
Total RNA from mouse spleens or thorac-abdominal aortas was extracted with TRI Reagent (MRC, Inc) according to the manufacturer’s instructions. Reverse transcription was performed using the Quantitect kit (Qiagen). Real-time PCR (ABI Prism 7000 Sequence Detection System, Applied Biosystems) was used to determine mRNA levels of CD4 (T-helper cell marker), Tim3 (T-helper 1 cell marker), Gata3 (T-helper 2-cell marker), and Foxp3 (regulatory T-cell marker) in spleens, whereas mRNA levels of endothelial NO synthase (eNOS), Ang II type 1 (AT1), and AT2 receptors were quantified in mouse aortas. The following primers were used: for CD4, 5'AGATCACAGTCTTCACCTGGAAGTT (sense) and 5'TGCCCCTTTTTTGGAATCAA (antisense); for Tim3, 5'GCCGGTGGACCTCAGTTTC (sense) and 5'-TGGGAGCCAGCACAGATCA (antisense); for Gata3, 5'CAGAACCGGCCCCTTATCA (sense) and 5'CATTAGCGTTCCTCCTCCAGA (antisense); for Foxp3, 5'GGCCCTTCTCCAGGACAGA (sense) and 5'GCTGATCATGGCTGGGTTGT (antisense); for eNOS, 5'TTGTCTGCGGCGATGTCA (sense) and 5'GAATTCTCTGCACGGTTTGCA (antisense); for AT1a receptor, 5'GTCGCACTCAAGCCTGTCTA 3' (sense) and 5'CCTGTCACTCCACCTCAGAA 3' (antisense); and for AT2 receptor, 5' CCCTAAAAAGGTGTCCAGCA 3' (sense) and 3' GCACATCACAGGTCCAAAAA 3' (antisense).
Statistical Analysis
No significant differences between sexes were found, and, therefore, results were averaged. Data are expressed as mean±SEM. The Mann–Whitney test was used for comparison between 2 groups. For multiple comparisons, 1-way ANOVA followed by Tukey’s test was used. Dose-response relationships were analyzed using 2-way ANOVA followed by Bonferroni’s test. Statistical analysis of plaque morphology was carried out using the 
2 test, if >20% of the expected frequencies were <5, we used the Fisher’s exact test to evaluate the exact P value. Values of P<0.05 were considered significant. The statistical software GraphPad was used for analysis.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Sedentary Mice
Hemodynamic and hormonal results are summarized in Table 1. Exercised ApoE–/– sham, 2K1C, and 1K1C mice were analyzed. Sedentary ApoE–/– sham, 2K1C, and 1K1C animals served as controls. As expected, in sedentary hypertensive 2K1C mice, PRC values were significantly above normal (Ang II–dependent hypertension model) as compared with control normotensive shams. In hypertensive 1K1C mice (Ang II–independent hypertension model), PRC levels were within the normal range. Plasma Ang-N in sedentary hypertensive 2K1C mice was significantly decreased (because of substrate consumption after renin activation) compared with sedentary normotensive sham and hypertensive 1K1C mice. In these 2 latter groups, plasma Ang-N levels remained normal. HR and body weight were not different among sham, 2K1C, and 1K1C sedentary animals.
|
Effect of Exercise on MBP, HR, Body Weight, PRC, Total Cholesterol, and Citrate Synthase Levels
Five weeks of swimming training had no significant effect on MBP in any group of mice (Table 1). Analysis of systolic and diastolic blood pressure values showed similar unchanged results between sedentary and exercised mice (data not shown). Along the same line, as observed in sedentary animals, after exercise, PRC remained significantly higher in 2K1C mice as compared with similarly trained sham and 1K1C animals (Table 1). Correspondingly, the plasma Ang-N substrate significantly decreased in exercised 2K1C mice (Table 1). As expected, HR was significantly lower in animals after swimming as compared with sedentary controls (P<0.05; Table 1). Body weight was not affected by swimming (Table 1). Likewise, plasma total cholesterol levels were not different among exercised and sedentary mice (data not shown). To verify that, indeed, swimming mice sufficiently exercised, muscle citrate synthase was measured and was found to be significantly increased after 5 weeks of swimming training in all 3 groups of mice (data not shown).
Swimming Prevents Atherosclerosis Progression in Hypertensive 2K1C Mice
Plaque analysis in sedentary mice showed in 2K1C animals a more vulnerable phenotype than plaques from similarly hypertensive 1K1C and normotensive sham mice, as described previously (decreased fibrous cap thickness, increased media degeneration, layering, and adventitia inflammation; P<0.05; Table 2).1 Moreover, SMC content was significantly decreased in plaques from 2K1C mice, as evidenced by the decrease in -smooth muscle actin (P<0.05; Figure 1A). Along the same line, in plaques from 2K1C mice, macrophage content was significantly increased (P<0.05; Figure 1B). Contrasting with sedentary 2K1C mice, plaques from sedentary hypertensive 1K1C mice showed a significantly more stable phenotype similar to that found in sedentary normotensive sham animals (Table 2 and Figure 1A and 1B).
|
|
Analysis of plaques from exercised mice revealed prevention of atherosclerosis progression in 2K1C animals. In fact, qualitative plaque evaluation from hypertensive 2K1C mice, after 5 weeks of swimming, showed a more stable phenotype as compared with equally hypertensive sedentary 2K1C animals (significantly thicker fibrous cap, decreased media degeneration, layering, and adventitia inflammation; Table 2 and Figure 1C through 1E). Along the same line, -smooth muscle actin content was significantly increased by 143% (P<0.05) in exercised as compared with sedentary 2K1C mice (Figure 1A). In addition, macrophage plaque content was significantly reduced by 35% (P<0.05) in exercised as compared with sedentary 2K1C mice (Figure 1B). The plaque phenotype of these exercised 2K1C mice was similar to that found in sedentary normotensive sham and sedentary hypertensive 1K1C animals.
Plaque staging also differed among exercised and sedentary 2K1C mice. Sedentary hypertensive 2K1C animals mainly developed advanced lesions (89% of mice), whereas only 25% of mice developed advanced plaques in the exercised hypertensive 2K1C group (P<0.05; Table 2). Swimming exercise did not seem to significantly affect the plaque phenotype of sham and hypertensive 1K1C mice as compared with sedentary ones (Table 2 and Figure 1A and 1B). No difference in plaque staging was observed among exercised sham or 1K1C and sedentary sham or 1K1C mice (Table 2).
As we have reported previously,1 the plaque surface in sedentary animals was significantly (P<0.05) and similarly increased in hypertensive 2K1C (168 704±21 897µm2) and 1K1C (172 142 ± 31 194 µm2) mice as compared with sham normotensive animals (63 931±13 145µm2). Swimming significantly decreased the plaque surface of hypertensive mice to values similar to those found in normotensive sham sedentary mice (57% decrease in 2K1C mice and 56% decrease in 1K1C mice; P<0.05).
Effect of Swimming on AT1 and AT2 Receptor Expression, Endothelial Function, eNOS Expression, T-Cell Phenotype, and Interleukin 6 Level
In the ApoE–/– 2K1C mouse model, plaque vulnerability is Ang II mediated, as we have shown previously.1 Five weeks of regular swimming prevented the development of vulnerable plaques in ApoE–/– 2K1C mice. Interestingly, in these animals, MBP and PRC were unaffected by exercise. Therefore, we investigated whether the beneficial effect of swimming may be induced by modulating vascular Ang II AT1 receptor expression. Quantitative mRNA analysis showed similar aortic AT1 expression levels among sedentary sham, 2K1C, and 1K1C mice (Figure 2A). After 5 weeks of swimming, a downregulation in aortic AT1 receptor expression was observed in all of the groups of mice (Figure 2A). This reduction was significant in exercised normotensive sham and hypertensive 2K1C mice compared with sedentary sham and 2K1C mice, respectively (P<0.05). In exercised 1K1C animals, AT1 expression was reduced by 23%, but the reduction did not reach significance (Figure 2A). Notably, the decrease in aortic AT1 mRNA levels in 2K1C animals correlated with the reduction in plaque macrophage content (r=0.80) and with the increase in SMC content (r=0.58). Downregulation of AT1 expression may result in an upregulation of the AT2 Ang II receptor. Therefore, mRNA analysis of AT2 was performed in the same aortic samples. Results showed no change in AT2 expression among sedentary and exercised mice. Moreover, no difference in AT2 expression was observed among normotensive and hypertensive mice (Figure 2B).
|
Ang II, via the AT1 receptor, has been linked to endothelial dysfunction.17 Therefore, we assessed whether aortic AT1 mRNA downregulation might be accompanied by improved endothelial function in our 2K1C exercised mice. For this purpose, endothelium-dependent and -independent vasorelaxations in isolated aortic rings were studied. Five weeks of swimming did not improve endothelial function in 2K1C mice (Figure 3A). Similarly, endothelium-independent sodium nitroprusside–induced vasorelaxation and phenylephrine-induced vasoconstriction were unchanged between exercised and sedentary mice (data not shown). Likewise, expression of eNOS, a key mediator of endothelial function and atherogenesis, was not altered in exercised compared with sedentary 2K1C mice (Figure 3B).
|
Ang II, via its AT1 receptor, is also known to modulate the T-cell phenotype, thus playing a role in atherogenesis. For this purpose, cell-type–specific transcript expression was studied in splenocytes of exercised and sedentary 2K1C mice. Results showed unchanged CD4 expression after swimming (Figure 4A). Likewise, Tim-3 (T-helper 1 lymphocyte marker), GATA3 (T-helper 2 lymphocyte marker), and Foxp3 (regulatory T-cell marker) appeared to be unaffected by swimming exercise (Figure 4B through 4D). Levels of plasma interleukin 6, a circulatory inflammation marker, were measured in sedentary and exercised 2K1C mice. Results showed no significant difference between the 2 groups of mice (285±45 ng/mL in sedentary mice versus 248±41 ng/mL in exercised mice).
|
Effect of Swimming on Plasma NE and Aldosterone Levels
Swimming is known to affect sympathetic tone. Therefore, plasma NE was measured in sedentary and exercised mice. NE plasma levels decreased after 5 weeks of swimming in all of the groups of mice, and this reduction reached statistical significance in the exercised 2K1C group (Table 1).
Aldosterone plays a pivotal role in blood pressure homeostasis and is a key element of the renin-angiotensin-aldosterone system (RAAS). Therefore, plasma levels were determined after exercise and compared with those found in sedentary animals. Mean plasma aldosterone was consistently higher after 5 weeks of swimming, but in parallel to slightly increased mean plasma renin, the increase was not significant.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our results show, for the first time, in a mouse model of Ang II–mediated vulnerable atherosclerotic plaques, that swimming can prevent atherosclerosis progression and plaque vulnerability. Moreover, the pivotal and blood pressure–independent role of Ang II in atherogenesis is newly emphasized.1 The beneficial effect of swimming was likely mediated by downregulating aortic AT1 receptor expression independent of any hemodynamic change.
In sedentary ApoE–/– mice, aortic AT1 receptor expression was not significantly different among sham, 2K1C, and 1K1C animals. After 5 weeks of swimming, all of the groups of mice showed a similar decrease in Ang II receptor mRNA levels. These findings of reduced AT1 mRNA levels in aortas of exercising mice, to our knowledge, have not been shown before. Alternatively, other authors showed reduced AT1 mRNA and protein levels in the central nervous system of rabbits with chronic heart failure undergoing treadmill exercise18 and decreased AT1 receptors in mammary arteries of trained versus untrained individuals.19 It may, therefore, be postulated that beneficial effects of exercise are mediated, at least partly, by reduced AT1 levels. Nevertheless, the universality of the observed exercise effect on AT1 receptor expression will have to be assessed in various organs and vascular beds and after various types of exercise to fully evaluate the potential role of this adaptation. We reported recently13 that AT1 blockade in 2K1C sedentary ApoE–/– mice prevents vulnerable plaque development. This supports the actual finding that decreased vascular AT1 expression may indeed play a direct role in plaque development. Moreover, a recent report shows that double AT1–/–/ApoE–/– mice have significantly reduced atherosclerosis size in nonexercised conditions.20 This observation further supports the role of AT1 receptors in plaque development.
Decreased aortic AT1 expression in exercised 2K1C mice was not accompanied by a compensatory upregulation of AT2 receptor expression nor by a decrease in blood pressure. Conversely, the observed modest increase in renin and aldosterone levels accompanied by a sizable reduction in Ang-N (–42% in 2K1C mice) suggested a stimulated RAAS and enhanced substrate consumption. Thus, in our mice, the benefit of exercise cannot be explained by reduced Ang II production or a hemodynamic effect.
After 5 weeks of swimming, 2K1C mice also showed a diminished sympathetic tone (significant decrease in plasma NE levels). This suppressive effect of exercise on the sympathetic system has also been observed by others.18 These trends for swimming-induced hormonal changes were seen in all 3 groups of exercised mice. An exercise-mediated reduction in sympathetic drive (reduced HR and NE levels) may necessitate a compensatory increase in RAAS activity to maintain adequate renal perfusion. Reduced AT1 receptor expression would, thus, reflect increased Ang II concentrations.
On the other hand, it is known that the RAAS and the sympathetic system work together in a synergistic way to assure blood pressure homeostasis.21 A cross-talk between the RAAS and the sympathetic system is, therefore, conceivable also at the receptor level. Reduced NE levels may have indirectly or directly reduced aortic AT1 receptor expression in our exercised mice.
The beneficial effect on plaque progression was clearly manifest only in exercised hypertensive 2K1C animals. This is not surprising. In young sham mice, lesions are at an early stage and spontaneously progress rather slowly in the absence of stimuli (high-fat diet, hypertension, RAAS stimulation, etc). Similarly, plaques from volume-overload hypertensive 1K1C mice, although at a more advanced stage than seen in sham normotensive animals, are of a stable phenotype. On the contrary, 2K1C mice rapidly develop advanced and vulnerable lesions during the 5 weeks after clipping because of increased endogenous Ang II production1,13 and, therefore, in these mice, the beneficial effect of exercise on atherosclerosis progression was readily demonstrated.
The question arises as to the possible mechanisms by which diminished vascular Ang II receptor expression could affect plaque progression. Certainly, a lower local Ang II signaling may protect the vessel wall from the proatherogenic effects of Ang II. One of the most frequently claimed negative effects of Ang II is impaired endothelial function. Therefore, we investigated whether exercise-induced AT1 downregulation could result in improved aortic endothelial function. This was not the case, and along the same line, aortic eNOS expression was not affected by swimming in our 2K1C mice.
Several lines of evidence suggest that regular aerobic exercise reduces established markers and mediators of inflammation, which are known to play a key role in the pathophysiology of atherosclerosis.22 Exercise reduces proinflammatory cytokines while increasing antiinflammatory ones in patients with coronary syndromes.23,24 Correspondingly, Ang II is known to negatively affect these same mediators.17 Therefore, we assessed whether, in our exercised 2K1C mice, modulation of the T-cell phenotype may explain the beneficial effect on plaque progression. However, no difference in balance among T-helper 1, T-helper 2, and T-regulatory cells was observed between sedentary and exercised mice.
Perspectives
Results reported here, if confirmed in clinical studies, should have clinical implications in terms of cardiovascular event protection. In fact, for hypertensive patients with an activated RAAS and presenting with clinical or subclinical atherosclerosis, swimming exercise may be an attractive adjuvant therapy for the prevention of atherosclerosis progression.
|
Acknowledgments |
|---|
We thank Françoise Nicoud, Irène Keller, Sylvie Bertholet, and Graziano Pelli for excellent technical assistance.
Source of Funding
This work was supported by the Swiss National Science Foundation (grant 3200BO-109900 to L.M.).
Disclosures
None.
Received December 17, 2008; first decision January 7, 2009; accepted March 12, 2009.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Mazzolai L, Duchosal MA, Korber M, Bouzourene K, Aubert JF, Hao H, Vallet V, Brunner HR, Nussberger J, Gabbiani G, Hayoz D. Endogenous angiotensin II induces atherosclerotic plaque vulnerability and elicits a Th1 response in ApoE–/– mice. Hypertension. 2004; 44: 277–282.
2. Naghavi M, Libby P, Falk E, Casscells SW, Litovsky S, Rumberger J, Badimon JJ, Stefanadis C, Moreno P, Pasterkamp G, Fayad Z, Stone PH, Waxman S, Raggi P, Madjid M, Zarrabi A, Burke A, Yuan C, Fitzgerald PJ, Siscovick DS, de Korte CL, Aikawa M, Airaksinen KE, Assmann G, Becker CR, Chesebro JH, Farb A, Galis ZS, Jackson C, Jang IK, Koenig W, Lodder RA, March K, Demirovic J, Navab M, Priori SG, Rekhter MD, Bahr R, Grundy SM, Mehran R, Colombo A, Boerwinkle E, Ballantyne C, Insull W Jr, Schwartz RS, Vogel R, Serruys PW, Hansson GK, Faxon DP, Kaul S, Drexler H, Greenland P, Muller JE, Virmani R, Ridker PM, Zipes DP, Shah PK, Willerson JT. From vulnerable plaque to vulnerable patient: a call for new definitions and risk assessment strategies: part II. Circulation. 2003; 108: 1772–1778.
3. Naghavi M, Libby P, Falk E, Casscells SW, Litovsky S, Rumberger J, Badimon JJ, Stefanadis C, Moreno P, Pasterkamp G, Fayad Z, Stone PH, Waxman S, Raggi P, Madjid M, Zarrabi A, Burke A, Yuan C, Fitzgerald PJ, Siscovick DS, de Korte CL, Aikawa M, Juhani Airaksinen KE, Assmann G, Becker CR, Chesebro JH, Farb A, Galis ZS, Jackson C, Jang IK, Koenig W, Lodder RA, March K, Demirovic J, Navab M, Priori SG, Rekhter MD, Bahr R, Grundy SM, Mehran R, Colombo A, Boerwinkle E, Ballantyne C, Insull W Jr, Schwartz RS, Vogel R, Serruys PW, Hansson GK, Faxon DP, Kaul S, Drexler H, Greenland P, Muller JE, Virmani R, Ridker PM, Zipes DP, Shah PK, Willerson JT. From vulnerable plaque to vulnerable patient: a call for new definitions and risk assessment strategies: part I. Circulation. 2003; 108: 1664–1672.
4. Bassuk SS, Manson JE. Epidemiological evidence for the role of physical activity in reducing risk of type 2 diabetes and cardiovascular disease. J Appl Physiol. 2005; 99: 1193–1204.
5. Gaesser GA. Exercise for prevention and treatment of cardiovascular disease, type 2 diabetes, and metabolic syndrome. Curr Diab Rep. 2007; 71: 14–19.
6. Thompson PD, Buchner D, Pina IL, Balady GJ, Williams MA, Marcus BH, Berra K, Blair SN, Costa F, Franklin B, Fletcher GF, Gordon NF, Pate RR, Rodriguez BL, Yancey AK, Wenger NK. Exercise and physical activity in the prevention and treatment of atherosclerotic cardiovascular disease: a statement from the Council on Clinical Cardiology (Subcommittee on Exercise, Rehabilitation, and Prevention) and the Council on Nutrition, Physical Activity, and Metabolism (Subcommittee on Physical Activity). Circulation. 2003; 107: 3109–3116.
7. Niebauer J, Hambrecht R, Velich T, Hauer K, Marburger C, Kalberer B, Weiss C, von HE, Schlierf G, Schuler G, Zimmermann R, Kubler W. Attenuated progression of coronary artery disease after 6 years of multifactorial risk intervention: role of physical exercise. Circulation. 1997; 96: 2534–2541.
8. Laufs U, Wassmann S, Czech T, Munzel T, Eisenhauer M, Bohm M, Nickenig G. Physical inactivity increases oxidative stress, endothelial dysfunction, and atherosclerosis. Arterioscler Thromb Vasc Biol. 2005; 25: 809–814.
9. Napoli C, Williams-Ignarro S, de NF, Lerman LO, Rossi L, Guarino C, Mansueto G, Di TF, Pignalosa O, De RG, Sica V, Ignarro LJ. Long-term combined beneficial effects of physical training and metabolic treatment on atherosclerosis in hypercholesterolemic mice. Proc Natl Acad Sci U S A. 2004; 101: 8797–8802.
10. Pellegrin M, Berthelot A, Houdayer C, Gaume V, Deckert V, Laurant P. New insights into the vascular mechanisms underlying the beneficial effect of swimming training on the endothelial vasodilator function in apolipoprotein E-deficient mice. Atherosclerosis. 2007; 190: 35–42.[CrossRef][Medline] [Order article via Infotrieve]
11. Shimada K, Kishimoto C, Okabe TA, Hattori M, Murayama T, Yokode M, Kita T. Exercise training reduces severity of atherosclerosis in apolipoprotein E knockout mice via nitric oxide. Circ J. 2007; 71: 1147–1151.[CrossRef][Medline] [Order article via Infotrieve]
12. Wiesel P, Mazzolai L, Nussberger J, Pedrazzini T. Two-kidney, one clip and one-kidney, one clip hypertension in mice. Hypertension. 1997; 29: 1025–1030.
13. Nussberger J, Aubert JF, Bouzourene K, Pellegrin M, Hayoz D, Mazzolai L. Renin inhibition by aliskiren prevents atherosclerosis progression: comparison with irbesartan, atenolol, and amlodipine. Hypertension. 2008; 51: 1306–1311.
14. Grouzmann E, Cavadas C, Grand D, Moratel M, Aubert JF, Brunner HR, Mazzolai L. Blood sampling methodology is crucial for precise measurement of plasma catecholamines concentrations in mice. Pflugers Arch. 2003; 447: 254–258.[CrossRef][Medline] [Order article via Infotrieve]
15. Nussberger J, Waeber B, Brunner HR, Burris JF, Vetter W. Highly sensitive microassay for aldosterone in unextracted plasma: comparison with two other methods. J Lab Clin Med. 1984; 104: 789–796.[Medline] [Order article via Infotrieve]
16. Skalli O, Ropraz P, Trzeciak A, Benzonana G, Gillessen D, Gabbiani G. A monoclonal antibody against alpha-smooth muscle actin: a new probe for smooth muscle differentiation. J Cell Biol. 1986; 103: 2787–2796.
17. Skultetyova D, Filipova S, Riecansky I, Skultety J. The role of angiotensin type 1 receptor in inflammation and endothelial dysfunction. Recent Pat Cardiovasc Drug Discov. 2007; 2: 23–27.[CrossRef][Medline] [Order article via Infotrieve]
18. Mousa TM, Liu D, Cornish KG, Zucker IH. Exercise training enhances baroreflex sensitivity by an angiotensin II-dependent mechanism in chronic heart failure. J Appl Physiol. 2008; 104: 616–624.
19. Adams V, Linke A, Krankel N, Erbs S, Gielen S, Mobius-Winkler S, Gummert JF, Mohr FW, Schuler G, Hambrecht R. Impact of regular physical activity on the NAD(P)H oxidase and angiotensin receptor system in patients with coronary artery disease. Circulation. 2005; 111: 555–562.
20. Eto H, Miyata M, Shirasawa T, Akasaki Y, Hamada N, Nagaki A, Orihara K, Biro S, Tei C. The long-term effect of angiotensin II type 1a receptor deficiency on hypercholesterolemia-induced atherosclerosis. Hypertens Res. 2008; 31: 1495–1497.[CrossRef][Medline] [Order article via Infotrieve]
21. Mancia G, Dell'Oro R, Quarti-Trevano F, Scopelliti F, Grassi G. Angiotensin-sympathetic system interactions in cardiovascular and metabolic disease. J Hypertens. 2006; 24 (suppl): S51–S56.
22. Wilund KR. Is the anti-inflammatory effect of regular exercise responsible for reduced cardiovascular disease? Clin Sci (Lond). 2007; 112: 543–555.[Medline] [Order article via Infotrieve]
23. Goldhammer E, Tanchilevitch A, Maor I, Beniamini Y, Rosenschein U, Sagiv M. Exercise training modulates cytokines activity in coronary heart disease patients. Int J Cardiol. 2005; 100: 93–99.[CrossRef][Medline] [Order article via Infotrieve]
24. Walther C, Mobius-Winkler S, Linke A, Bruegel M, Thiery J, Schuler G, Halbrecht R. Regular exercise training compared with percutaneous intervention leads to a reduction of inflammatory markers and cardiovascular events in patients with coronary artery disease. Eur J Cardiovasc Prev Rehabil. 2008; 15: 107–112.[CrossRef][Medline] [Order article via Infotrieve]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||